Categories
help writing college papers

Management Of Financial Institutions

Management of Financial Institutions

1.As a senior loan officer at Joshua Bankcorp you have the following loan applications waiting for review. The bank uses Altman’s Z score, default probabilities, mortality rates and RAROC to assess loan acceptability. The bank’s cost of equity (the RAROC benchmark) is 9 percent. The bank’s loan policy states that the maximum probability of default for loans by type is as follow:

Loan Type and Maturity Maximum Allowable Default Probability
AAA-rated 0.50%
A-rated 1.25

[Note: In all of the following 4 loan applications (a through d), you have to identify whether you accept or reject the loan applications and why?]

  1. An AAA-rated, one-year C&I loan from a firm with a liquidity ratio of 2.15, a debt-to-asset ratio of 45 percent, volatility in earnings of 0.13, and a profit margin of 12 percent. Joshua Bankcorp uses a linear probability model to evaluate AAA-rated loans as follows:

PD = –0.08X1 + 0.15X2 +1.2X3 – 0.45 X4

Where,  X1= Liquidity ratio; X2=Debt-to-asset ratio; X3=Volatility in earnings; X4= Profit Margin

PD = –0.08(2.15) + 0.15(.45) +1.2(.13) – 0.45(.12)

PD= -.175+.0675+.156-.054= -.0055

Accept loan

  • An AA-rated, one-year C&I loan from a firm with the following financial statement information (in millions of dollars):
Assets   Liabilities and Equity  
Cash Accounts receivables Inventory Plant & Equipment $ 40  120  210 1,100 Accounts payable Notes payable Accruals Long-term debt Equity (retained earnings = $200) $ 55    60    70  550  735
Total Assets       $1,470 Total liabilities and equity $1,470

Also assume sales = $1,250 million, cost of goods sold = $930 million, and the market value of equity is equal to 2.2 times the book value of equity. Joshua Bankcorp uses the Altman’s Z-scoremodel to evaluate AA-rated loans. 

1250-1100=150

Loan unacceptable

  • An A-rated corporate loan with a maturity of three years. A-rated corporate loans are evaluated using the mortality rate approach. A schedule of historical defaults (annual and cumulative) experienced by the bank on it’s A-rated corporate loans is as follows:
  Years after Issuance    
Loan Type A-rated Corporate loans Annual default Cumulative default 1 year 2 years 3 years 4 years
0.10% 0.10 0.25% 0.325 0.40% 0.595 0.65% 1.858

1.858>.5

Loan not acceptable

  • A $2 million, 5-year loan to BBB-rated corporation in the computer parts industry. Joshua Bankcorp uses a RAROC model and charges a servicing fee of 75 basis points. The duration of the loan is 4.5 years. The cost of funds for the bank is 8 percent. Based on four years of historical data, the bank has estimated the maximum change in the risk premium on the computer parts industry to be approximately 5.5%. The current market rate for loans in this industry is 10%.

4.5 x 2 / 75 = 9/75

Loan Acceptable

2.As a senior loan officer at Marisa Financial Corp, you have a loan application from a firm in the biotech industry. While the loan has been approved on the basis of an individual loan, you must evaluate the loan based on its impact on the risk of the overall loan portfolio. The Marisa Financial Corp uses the following three methods to assess its loan portfolio risk. Should Marisa  Financial Corp. grant this loan based on the following 3 criteria and why or why not? 

  1. Concentration Limits – The Marisa Financial Corp currently has lent an amount equal to 40 percent of its capital to the biotech industry and does not lend to a firm in any sector that generates losses in excess of 2 percent of capital. The average historical losses in the biotech industry total 5 percent.

Losses less than industry 5%

lend a loan

  • Loan Volume-based Model – National and Marisa Financial Corp’s loan portfolio allocations are as follows.

Allocation of Loan Portfolios in Different Sectors (%)

               Sectors NationalMarisa Financial Corp            
                Commercial       30%                         40%                       
                 Real Estate       50%                         45%                       
                Consumer       20%                         15%    

     Marisa Financial does not want to deviate from the national average by more than 12.25 percent.

Commercial 70%

Real estate 95%

Consumer 35%                                                      

Grant loan to commercial and real estate sector not to the consumer sector

  • Loan Loss Ratio-based Model – Based on regression analysis on historical loan losses, the Marisa Financial Corp estimates the following loan loss ratio models:

                                   XC&I = 0.001 + 0.85XL; and 

                                   Xcon = 0.003 + 0.65XL

         where XC&I = loss rate in the commercial sector, Xcon = loss rate in the consumer (household) sector, and XL = loss rate for its total loan portfolio. Marisa Financial Corp’s total increase in the loan loss ratio is expected to be 12 percent next year.

XCL=0.001+13.35%=14.35%

Xcon=0.003+12.76%=15.76%

No loan to be granted

3.Bank of Marconi has the following balance sheet (in millions).

                        Assets     Liabilities and Equity  
                        Cash    $9   Deposits $75
                        Loans  95   Purchased funds 40
                        Securities    26   Equity    15
                        Total assets $130   Total liabilities and equity $130

Bank of Marconi’s securities portfolio includes $16 million in T-bills and $10 million in GNMA (Government National Mortgage Association) securities. Bank of Marconihas a $20 million line of credit to borrow in the repo market and $5 million in excess cash reserves (above reserve requirements) with the Fed. Bank of Marconicurrently has borrowed $22 million in Fed funds and $18 million from the Fed discount window to meet seasonal demands.

  1. What is the Bank of Marconi’s total available (sources of) liquidity? What is the Bank of Marconi’s current total uses of liquidity? What is the net liquidity of Bank of Marconi?

Net Liquidity=9-75= -64

  • Calculate the financing gap of Bank of Marconi. What is its financing requirement?

Gap=95-40=35

  • Bank of Marconiexpects a net deposit drain of $20 million. Show the Bank of Marconi‘s balance sheet  if the following conditions occur:
    • Bank of Marconipurchases liabilities to offset this expected drain.

The liabilities would decrease which would encourage the injection of fresh equity

  1. The stored liquidity management method is used to meet the expected drain (Bank of Marconidoes not want the cash balance to fall below $5 million, and securities can be sold at their fair value).

If securities are drawn out it can be seen that the sales should be of $87(95+4-11)

        4. Suppose Bank Kevin, a U.S. Financial Institution (FI)  has the following assets and liabilities:

            $500 million                            $1,000 million
           U.S. loans (one year)               U.S. CDs (one year)
            in dollars                                       in dollars                   

                            Assets                                                   Liabilities                  

                           $300 million equivalent

                           U.K. loans (one year)

                           (loans made in pounds)                                            

                           $200 million equivalent

                           Turkish loans (one year)

                           (loans made in Turkish lira)                                                     

The promised one-year U.S. CD rate is 4 percent, to be paid in dollars at the end of the year; the one-year, default risk–free loans in the United States (U.S.) are yielding 6 percent; default risk– free one-year loans are yielding 8 percent in the United Kingdom (U.K.); and default risk–free one-year loans are yielding 10 percent in Turkey. The exchange rate of dollars for pounds at the beginning of the year is $1.6/£1, and the exchange rate of dollars for Turkish lira at the beginning of the year is $0.5533/TRY1.

=200*.5533=101.22

  1. Calculate the dollar proceeds from Bank Kevin’s loan portfolio at the end of the year, the return on Bank Kevin’s loan portfolio, and the net interest margin for Bank Kevin if the spot foreign exchange rate has not changed over the year.

=101.22-12.22=99

  • Calculate the dollar proceeds from Bank Kevin’s loan portfolio at the end of the year, the return on Bank Kevin’s loan portfolio, and the net interest margin for Bank Kevin if the pound spot foreign exchange rate falls to $1.45/£1 and the lira spot foreign exchange rate falls to $0.52/TRY1 over the year.

=101.22*1.45=152.34

  • Calculate the dollar proceeds from Bank Kevin’s loan portfolio at the end of the year, the return on Bank Kevin’s loan portfolio, and the net interest margin for Bank Kevin if the pound spot foreign exchange rate rises to $1.70/£1 and the lira spot foreign exchange rate rises to $0.58/TRY1 over the year.

=101.22*1.7=185.34

5. Blake and George (BG) Bankcorp wants to obtain the DEAR on its trading portfolio. The portfolio consists of the following securities.

      Fixed-income securities: 

  1. BG Bankcorp has a $1 million position in a six-year zero bonds with a face value of $1,543,302. The bond is trading at a yield to maturity of 7.50 percent. The historical mean change in daily yields is 0.0 percent, and the standard deviation is 22 basis points.
  1. BG Bankcorp also holds a 12-year zero bond with a face value of $1,000,000. The bond is trading at a yield to maturity of 6.75 percent. The price volatility if the potential adverse move in yields is 65 basis points.

     Foreign exchange contracts:

BG Bankcorp  has a €2.0 million long trading position in spot euros at the close of business on a particular day. The exchange rate is €0.80/$1, or $1.25/€, at the daily close. Looking back at the daily changes in the exchange rate of the euro to dollars for the past year, BG Bankcorp finds that the volatility or standard deviation (σ) of the spot exchange rate was 55.5 basis points (bps).

      Equities:

BG Bankcorp holds a $2.5 million trading position in stocks that reflect the U.S. stock market index (e.g., the S&P 500). The β = 1. Over the last year, the standard deviation of the stock market index was 175 basis points (bps).

Correlations (ρij) among Assets are given below:

______________________________________________________________________________________

Six-year zero-coupon      12-year zero-coupon      €/$                   U.S. stock index

Six-year, zero-coupon             –                                  0.75                   -0.2                   0.40
12-year, zero-coupon              –                                    –                        -0.3                  0.45
€/$                                            –                                    –                        –                      0.25
U.S. stock index                       –                                    –                         –                       –

Calculate the DEAR (Daily Earnings at Risk) of this trading portfolio of BG Bankcorp.

Beta=.75-.2-.3+.4+.4=1.45

6.Jakob& Jon (J&J) National Bank has issued the following off-balance-sheet items: 

  • A one-year loan commitment of $1 million with an up-front fee of 40 basis points. The back-end fee on the unused portion of the commitment is 55 basis points. The bank’s base rate on loans is 8 percent, and loans to this customer carry a risk premium of 2 percent. The bank requires a compensating balance on this loan of 10 percent to be placed in demand deposits and must maintain reserve requirements on demand deposits of 8 percent. The customer is expected to draw down 75 percent of the commitment at the beginning of the year. 
  • A one-year loan commitment of $500,000 with an up-front fee of 25 basis points. The back-end fee on the unused portion of the commitment is 30 basis points. Loans to this customer carry a risk premium of 2.5 percent. The bank will not require a compensating balance on this loan. The customer is expected to draw down 90 percent of the commitment at the beginning of the year.
  • A three-month commercial letter of credit on behalf of one of its AA-rated customers who is planning to import $400,000 worth of goods from the Germany. The bank charges an up-front fee of 75 basis points on commercial letters of credit (LC) to AA-rated customers. 
  • A standby letter of credit (SLC) to one of its A-rated customers who is planning to issue $5 million of 270-day commercial paper for an effective yield of 5 percent. The corporation expects to save 50 basis points on the interest rate by using the SLC. The bank charges an up-front fee of 40 basis points on SLCs to A-rated customers to back the commercial paper issue?
  1. What up-front fees does the J&J National Bank earn on each of these? 

Total upfront fees=10%+25%+75%=110% from this portfolio

  • What other income does the J&J National Bank earn on these off-balance-sheet activities?

Brokerage and trading profits are some other profits from these ventures

  • Calculate the returns on each of the off-balance-sheet activities assuming that the takedowns on the loan commitments are at the expected percentage and the customers holding the letters of credit do not default on their obligations.

110%/5=22% returns

7.The operations department of a major financial institution (Tamim & Rita Bank) is planning to reorganize several of its back-office functions. Its current operating expense is $1.5 million, of which $1 million is for staff expenses. The FI uses a 12 percent cost of capital to evaluate costsaving projects.

  1. One way of reorganizing is to outsource a portion of Tamim & Rita Bank’s data entry functions.  This will require an initial investment of approximately $500,000 after taxes. The Tamim & Rita Bank expects to save $150,000 in annual operating expenses after taxes for the next seven years. Should it undertake this project?

5000000-150000=350000 should be undertaken

  • Another option is to automate the entire process by installing new state-of-the-art computers and software. The Tamim & Rita Bank expects to realize more than $500,000 per year in after-tax savings, but the initial investment will be approximately $3 million. In addition, the life of this project is limited to seven years, at which time new computers and software will need to be installed. Using this seven-year planning horizon, should the Tamim & Rita Bank invest in this project? What level of after-tax savings would be necessary to make this plan comparable in value creation to the plan in part (a)?

NPV of the first alternative

Npv(12%,cashflows 1.5 million)=1.05million

NPV of the second alternative

Npv(12%,cashflows 1million)=.93 million

NPV of the Third alternative

Npv(12%,cashflows .5 million)=.32 million

Categories
help writing college papers

Credit Scoring and Data Mining

Credit Scoring and Data Mining

Question 2: Data Mining Academic Paper Review

Personal health indexing based on medical examinations: A data mining approach

Ling Chen, Xue Li, Yi Yang, Hanna Kurniawati, Quan Z. Sheng, Hsiao-Yun Hu, Nicole Huang

Chen, L., Li, X., Yang, Y., Kurniawati, H., Quan Z. Sheng, H.-Y. H., & Huang, N. (2016). Personal health indexing based on medical examinations: A data mining approach. Decision Support Systems , 81, 54–65.

Data Mining Problem

The whole world population is increasing day by day and the health practices are more in demand. These practices shorten whenever new disease or issue in personal health care segment approaches the society. The latest issue is while measuring the personal health index (PHI). Geriatric medical examination (GME) is only method globally used for elderly health care monitoring is about to lose its leadership in the market. The devices reading the personal health index are many in the technological world, enriched with data mining features. The problem considered over here is to predict the personal health index. Further, the PHI prediction was not possible with error enriched medical records. Those medical records are infrequent and almost incomplete not motivating for health care sector.

The data mining techniques used

The understanding of Geriatric medical examination (GME) was important to explore the predictive sector of health index. The complete evaluation of these records was possible to use common techniques of data mining rather creative one. The study was important because authors used classification methods of data mining to explore those GME records necessary for the predicting personal health index (PHI) in most appropriate way.

The results reported

The prediction of PHI is different with clean cases as compared to noisy cases. The clean cases with some targeted disease individuals and noisy cases are some no-targeted cases.  Both cases are different while predicting gaps. The noisy case always showed the gap between PHI while predicting it.

Critical discussion

The model of classification of data mining showed that the method is best and explicit in delivery process management. The disease category grouping is another way that showed that the method is reliable to use. The other best thing with the method that it considered experiment setup in the best way by considering Linear support vector machines (LinSVM) and logistic regression (VR) approach in the same report. The class-weighted versions are best one showed exactly same approach towards the ultimate goal of predicting PHI. The last perspective was good to treat both noisy and clean cases at the same range because it may evaluate the required aspect inappropriate manner. 

Question 3: The Internet of Things (IoT) refers to the network of interconnected things such as Sensors

Predictive and descriptive analytics

My choice of the internet of things (IoT) is personal health care and its development by using different analytic and disruptive perspective. The health care sector is wide one because it has been targeting human population for long. The use of formal model along the best exploitation of service model can handle things in detail. The objects, services as well as the recommendation plan for health care are something entirely based of IoT in depth. The descriptive analytics showed that how it can evaluate the IoT through standard communication protocols. The health care via the internet-of-things is possible to eradicate through immediate evaluation of technology and this time with mobile. The communication is easy to exploit the best health care advantages extract from health care practices normally. The IoT is used to share activities based on personal health care aspect. Mostly the help of third party services is beneficial while using the IoT as the medium (Mashal, Alsaryrah, & Chung, 2016).

Evaluate the performance of the analytical models

            The usefulness of third party services may address issues through IoT services recommendation. The best system is one that may allow things as one of best way by utilizing things in detail. The recommendation of services is about to show the same strength while using the services. The model used for the health care protection can explore the user aspect in detail for best implication by exploring user as ownership of communication model. The graph approach is the only way to identify needs and demands of users along with some issues if the user is facing by using the service. The graph approach is there because it can enhance recommendation perspective because it may believe to give IOT as a medium. Another model is being used by different applications IoT inappropriate way. The first aspect is about the content-base filtering as CB. The CB is a common system in which the content or text is required to get access towards the user profile. The CB flirtation is the best way being used today and best as compare to many other techniques over there. The content-based filtering known as CB is there because it can evaluate process is the best way to assure the user safety. The content filtering is a little bit different from the collaborative filtering because collaborative filtering does not only depend on upon texts only (Mashal, Alsaryrah, & Chung, 2016).

Issues

There are issues when data miners’ engineers think for the future. The first perspective is the challenge of approach as well as the future development at the time when it is best with the differential aspect. The IoTSRS termed as IoT service recommendation is about to show that what is the difference between active and non-active user. The active user is only who is superior as compared to non-active because it depends on upon the heterogeneous controlling that is challenging for the effective implementation of the IoT (Mashal, Alsaryrah, & Chung, 2016).

Opportunity and challenges

            The challenge is to manage item based console as compared to the user based because Item based console required a different mechanism for different platforms. The opportunity over here is to collect data of user’s at a large rate so that data can use at different ranges with perfect combinations. One is recommending that health care at a personal level through data approach is possible when Content Based (CB) amalgamates with the Collaborative filtering (CF) (Mashal, Alsaryrah, & Chung, 2016).

Question No 4: Explain the following concepts

Information Value of a variable

The predictive value of the variable is possible through information value aspect because it is entirely a compare and contrast aspect. There are different values of different variables but those values are merely used as comparing aspect between one variable to another. The information value of variable determines the weight of evidence inappropriate way. The information value is the best by-product with the output aspect of flow of table of information. The way is all about the exploration of data through information required for the data mining aspect of values. The list of data categories are there at one column exactly reflects information value perspective at other (Zhang, Ji, & Liu, 2010).

Validation data set in a decision tree context

The validation data set is all about the errors perspective to show that how it can explore errors in development. The random pattern in the data is about the best data mining perspective to allow activities relevant to a decision tree. The decision tree is about the presentation of the instances in the validation by comparing to other narratives. The measuring perspective of error rate is about to show that how it can validate removal of one variable as compared to other. The production of validation set is another theatrical way to ensure that source of error is validated. The greatest perspective over here is about the reduction of error pruning which Validation data set in a decision tree context is being used (Zhang, Ji, & Liu, 2010).

Outlier truncation

            The term associated with the data perspective to show that how it may address issues in required form. The remote tail end is a perspective that analyzes the usage of data in perfect manner. The tail ends of data are known as outliers and it can apply to any data perspective. The best replacement factor over here is the perfect combination to show the usage of data in required form. The normalization of maximum and minimum use of data is there to explain the fact perfect for statistical data perspective (Zhang, Ji, & Liu, 2010).

LGD in the Basel context

The Loss Given Default is about the measuring things with a statistical model. The mode is activated when activities are underlying with the biggest accord that was signed and termed as Basel Accord. The Schuermann in 2004 is about to analyze the definitions of LGD at one end and measuring the LGD in Basel context in another. The recovery distribution in by model is required whenever it takes a position within Basel context in the best way (Zhang, Ji, & Liu, 2010).

Reference

Chen, L., Li, X., Yang, Y., Kurniawati, H., Quan Z. Sheng, H.-Y. H., & Huang, N. (2016). Personal health indexing based on medical examinations: A data mining approach. Decision Support Systems , 81, 54–65.

Mashal, I., Alsaryrah, O., & Chung, T.-Y. (2016). Performance evaluation of recommendation algorithms on Internet of Things services. Physica A , 451, 646-656.

Zhang, Y., Ji, L., & Liu, F. (2010). Local Housing Market Cycle and Loss Given Default: Evidence From Sub-Prime Residential Mortgages. International Monetary Fund.

Categories
help writing college papers

Stakeholder Engagement Nike’s Considerations

Stakeholder Engagement

Nike’s Considerations

Introduction

    In this study, we will discuss one of leading footwear, apparel, equipment and Service Company. The Nike is an American company and talks some customer considerations to have their thoughts and opinions to react accordingly in the competitive market. The purpose of this study is to observe Nike intentions towards customers, which depict care, loyalty, and satisfaction. The company has a large customer base around the globe, which is a result of intense customer considerations.

Stakeholder Engagement (consumer’s opinions and thoughts)

    The Nike Company gathers all stakeholders at the same vision, mission, and different strategic goals. The most prominent stakeholder is customers for this company to consider and have an opinion to improve different business operations and come up with effective price and quality to gain satisfaction.  This is a fact that Nike business in on fire in recent years due to key focus on specific demographics. For Instance, the main targets are women, young athletes, and runners for this company. These are company’s prominent stakeholders, as the management conducts perfect marketing intelligent to derive new trends and requirements from these customers.

    The main consideration of Nike Company is that its starts everything with customers. For Instance, the management listens to the customers to know the facts and masters to gain customers satisfaction.  The management of this company conducts different surveys with the passage of time to have different opinions regarding product developments, pricing and comparison with immense competitors in the market. This is a valuable feedback, as customers of Nike are responsive and behave according to their satisfaction level.

Apart with customer surveys to have opinion and thoughts, the management of this company is developing new products. How can customers accept all new products from Nike? The answer is intense customer experience that thus company has gained in decades.  For Instance, if Nike intends to produce a need product, this is a result of valuable feedback, opinion and thoughts of customers through digital and social media channels.

    Interestingly, the key focus has been shifted towards social media channels to market its products and have opinion and feedback regarding products and services. This is interesting to see that the customers are responsive and provide some technical details and requirements regarding products. It means that Nike all information regarding technical aspects and features of the products to let customers drive their demands from it and share with the company to have further developments.

    This is all about stakeholder engagement, and opinions from customers are prominent in this regard. This company has differentiated customer services and complaints handling process from taking material and thoughts, which is rare in this industry. The role of technology and innovative tools, used by the management has helped them to make this process effective and lucrative for the company. The management navigates different technological tools to depict its attachments with customers and know the facts regarding satisfaction, flaws and user experience.

    The digital strategy and business intelligence come into life, as the management use technological tools to build an online community. This company comes colder to its users to sustain strong engagements and long-term relationship. In result, the management often has valuable opinions and thoughts, which are never experienced before. The building of an online community is the main consideration by the company to have different opinions and thoughts.

    The Nike Company has differentiated opinions and thoughts from customers. For Instance, in an online community on social media, the management takes customers opinions to improve product quality and add different features in products according to new trends in the market. On the other hand, this is observed that the Nike take customer’s thoughts to come up with innovations at the workplace. This can be said that Nike products are results of different opinions and thoughts, which is a prominent reason for the success of this company.

Conclusion

    In this study, we discussed Nike and its engagement with customers in a competitive market. This is observed that quality, creativeness, and innovation are results of different customer opinion and thoughts, derived from different social media channels. The online community, developed by the management is effective and lucrative for both, the organization and customers to sustain long-term relations and depict one of the finest platforms to have opinion and thoughts.

References

Jackson, A. L. (2015, November 20). S&P 500 Has Best Week in 2015, Nike Paces Consumer Shares Rally. Retrieved April 4, 2016, from Bloomberg: http://www.bloomberg.com/news/articles/2015-11-20/u-s-index-futures-rise-with-s-p-500-poised-for-best-week-in-six

JONES, R. (2015, April 16). Nike’s Most Important Customers are Actually Teenagers and Here’s Proof. Retrieved May 4, 2016, from Complex: http://www.complex.com/sneakers/2015/04/nike-number-one-teen-retailer

Categories
help writing college papers

IT infrastructure plan

Strategic plan implementation road map 

Strategic direction and technology initiatives 

Strategic direction of the company is crucial for visualizing its strategic goals and objectives.  Strategic direction is necessary for the alignment of the IT infrastructure developmental project to the overall strategic objective of the company. Therefore, the vision of the company is utmost important to develop. The vision of the company sets the direction for the strategic objectives and their alignment with the vision. The pooch troop’s vision is to provide day care mobile services to protect the animal rights and developing a happy balance for pets that owners are at vacation or busy in their daily work schedule.  As it is startup therefore, everything related to IT infrastructure need to be purchased because IT infrastructure is needed for the company in first year. This is also aligned with strategic objectives of the start up as IT infrastructure would assist the company with its strategic plans. 

This is the potential and competitive scenario of utilization of a new Non-profit. It can be seen that if a new product is developed and the commercialization of components of this Non-profit organization coincide. This denotes that the potential weightage of the internal processes falls on the adaptation of IT System and in order to promote it well. It can be emphasized that the marketing and administrative costs are well adapted.

Need for new IT infrastructure is necessary in order to implement the vision. This would enhance the efficiency of internal process and it would further promote the business prospects. IT infrastructure makes processed measurable and to the point. In the result, resources are utilized and consumed in better way. This increases and ensures efficiency further which is suitable for sustainability of internal processes and businesses of the new startup. The pooch troop requires constant online monitoring, developing data base for the information of the pet and their owners and alike. Thus, replacement and procurement of existing IT infrastructure is quiet necessary to provide state of the art services. The technology initiatives that will be taken in that regard will be replacement and purchase of the IT software and hardware, servers, installation of new camera and online monitoring tools. The procurement of new IT infrastructure would be decided to purchase on two grounds, i.e. purchase of new equipments in IT infrastructure would enable the startup to come up with expectations of modification of internal processes and business promotion and second need is to replace IT infrastructure components which are older one and they need to be replaced. Thus, IT infrastructure procurement or purchase would be based on purchase of new components necessary for enhancement of internal processes and businesses. Replacement would let the startup to change outdated technologies or the components which are not efficient enough. This would also help the new startup to enhance its strategic vision through investment in internal processes and business prospects. 

Prioritized strategic initiatives

The major strategic initiative of the company is to buy its IT infrastructure. The IT infrastructure is the combine set of software and hardware along with networking facilities that are required to develop, deliver, monitor, control and support IT services in the company. The first prioritized strategic decision would be the replacement of the IT server in the company. The replacement and purchasing of the main server will enhance the IT capabilities of the company. After wards, the hardware and software will be purchased. The hardware connected with main server will be replaced with advanced infrastructure. With the replacement of the hardware, the software will be bought accordingly. These are important prioritized strategic initiatives that are necessary for the company to take in order to buy its IT infrastructure. The priority is enabling new IT infrastructure to function in full efficiency and effectiveness. This priority would be met with timely decisions regarding IT infrastructure and those decisions are related with purchase of new components or complete IT infrastructure in addition with replacement of components. 

Initiatives for implementation time frame 

The strategy will be implemented gradually. The quick and at once replacement of the IT infrastructure could be problematic. Therefore, gradual replacement of the IT infrastructure is needed in order to implement the strategy. The replacement and procurement will require one year of completing. The initiatives will be taken in order to complete the project in one year. First change will be bringing with the replacement of the main server. This will take almost four months to retrieve data from the old severs. After that, within six months, hardware and software will be replaced and purchased and finalization will be done later on. Thus, the investment on IT infrastructure is time bound but it is gradual process. 

 Time frame 
InitiativesJanFeb MarAprMayJunJulAug SepOctNovDec
Main server replacement            
Replacement of hardware and software             
Replacement of networking facilities             
Finalization             

High level investment estimate 

Excel Attached

Categories
help writing college papers

POST And Pre LAB

Pre Lab Question No: 1

1)

Angle θ can be calculated as

θ = l/r

Where l is length of arc and r is radius of arc

2)

2 radians = 360 degrees

I radian = 180/ degrees

I degree = 1 / 180 radians

A = 2 radians

There are 2 radians in one complete circle.

3)

Initial position is in east direction after rotating counterclockwise at a distance of θ = 2 radians we will be in the same direction as before rotation.

Because 2 radians is complete 360 degree rotations.

4)

Spin rate = 1 radian / 1 sec

How long it take to complete 2 rotations:

1 radians = Rotation in 1 sec

2 radians = 360 degrees

2 radians will be completed in 2 second.

5)

One spin = 360 degrees

As we know 360 degrees = 2 radians

Time taken to complete one spin = 25 seconds

Spin rate is given as radians / seconds = ω = 2 radians /25 seconds

ω = 0.08 radians / seconds

6)

Radii of new toilet paper = r1 = 10cm

Radii of used toilet paper= r2 = 5cm

Length pulled from each paper= 1 meter = 100cm

Angular distance =θ =?

For new toilet paper

θ new = l x r

= 100 x 10 = 1000m

For used toilet paper

θ used = l x r

= 100 x 5 = 500m

POST LAB

1)

Centripetal acceleration = ω = 98 m/s2

r = 11 m

  1.  

Tangential velocity = v t= r ω

= 11 x 98

=1078 m / s

  1.  

 v t= r ω

v/ R = ω

1078/11 = 98

  1.  

Angular acceleration

=  a = v2 / r

= (98 )2  /11

=873.0

  1.  

When it speed ups angle increases from θ to 2 θ

Question No:2

1

Speed is increasing.

2

Speed is decreasing

3

Disk is slowing down.

4

Speed is increasing.

5

Disk is moving with constant speed.

Categories
help writing college papers

RIGHT TIMES UNIFORM

Summary

The case is about the selection of a sales person for the company Right Times Uniform. Right Times Uniform provides a vast variety of uniform for the business people so they can look professional and have a good impact on customers. Even in their own organization, Right Time Uniform provides uniform to their employees so they can leave a positive impact on public and this is also a method of marketing their uniforms. Steven Zhang, which is the regional director of the sales, Tony Brooks who is district sales manager and Peggy Philips who is a regional sales trainer, try to select a candidate from a list of three people who are already interviewed and all information regarding them is collected. A conversation is held among these three people mentioned above and at the end a final candidate is selected out of all the three candidates, after a review of 30 minutes on their resumes, and their issues.

The recruitment and selection process started when the Right Times Uniform required a sales person. The advertisement was posted on the company website. An additional advertisement was also posted in the local newspaper. Three candidates showed interest and came up for an interview on the mentioned location. The names of the candidates are David, Kathy and Tim. Tim found the ad on the website while Kathy saw it in the local newspaper. David came from another source. He came with the reference of Richard which was Tony’s acquaintance. All three candidates were interviewed, and different aspects of their lives were also analyzed along with their abilities and skills analysis.  Kathy was found to be engaged and soon had marriage and moving plans. Tim came from New Orleans and was supposed to be Catholic and it was an issue for him to fit in such place here at company’s location, Salt Lake City. David was convicted of a felony and it was not suitable to hire a felon for payroll. Thus, all three candidates came up with an issue for the Right Times Uniform and it was difficult and crucial maybe to select one out of these three. Although the deciding committee tried to solve up this issue and at the end they came up with the solution of whom to hire, after 30 minutes log discussion and analysis of applications.

Question 1

The recruitment was done by posting an advertisement on the website and local newspaper. The pool of candidate was selected for interview and further recruitment and shortlisting was performed after analyzing the resumes, interview session with candidate and important notes were taken during interview regarding the candidate. Although this was a right approach to select and recruit people. There can be further addition in advertisement approach as now a days people use social networks too much; there should be a notification on social networks pages that the Right Times Uniform require a sales person. This may have a positive impact on hiring and recruitment.

Question 2

A personality test or psychology test must be taken to choose the right sales people. The sales people are those who do the marketing of products of the company and try to convince customers with a positive impact. Therefore analyzing the personality and psychology of the sales person is important, that how will they influence people? The sales persons are the representatives of the company. They are supposed to leave a positive and attractive impact on the customers and public.

Question 3

Some of the questions asked were personal, on which the candidates hesitated too. Therefore, this kind of questions must not be asked directly. Like asking Kathy regarding the kids and marriage plan was not suitable for the situation. The religious question asked by Tim was also risky. It is suggested that the questions ask to a candidate should neutral and general. Further, most personal questions and religious questions are not feasible to ask. It creates some conflict and person can feel uncomfortable from the situation. Therefore, questions shall select with care. Most feasible way to ask the question is about qualification and work experience. Condition and situations also impact or influence on questions or behavior of the person.

Categories
help writing college papers

Medical Insurance

Medical Expense Insurance: What is it? How does it work? Basic, major medical? Individual / Group ? Managed care? HIPPA?  COBRA?  Taxation?

As the time has progressed, medical sciences and technology have advanced, which has allowed people to live healthy lives for a longer period. The advances, in the realm of medical science and medicine, has allowed physicians and medicine practitioners to easily diagnose disease and provide quality health services through various medical instruments, which include medicine. However, when we study statistics, regarding diseases and cost of health cost services, we learn that not only large number of people dies from preventable diseases, but also a t a certain stage, in certain countries, the cost of medical services is very high. For instance, in United States, there exists to health system, Public health and Private Medicine. Because of the structure of industry, access to resources and method to use resources, these systems differ. Public Health care services provide affordable medical serves, whereas private medicine or health system provides quality health services at individual level.

Studies reveal that at a state, of a disease, the medical expenses are enormous and for an individual, who desires quality health services, at personal level, it becomes difficult to meet these medical expenditures/expenses. As per some studies, most of the Americans go bankrupt, because of the medical expenses. Therefore, most of the individuals opt for Medical/Health insurance, which covers medical and surgical expenses, of an individual, when he/she needs medical/health services in a hospital (could be private or public). Therefore, we can say that Medical Insurance covers medical expanses when an individual, group or family needs it (TLD, 2016).

How it works?

An individual, group or family could buy insurance as per his/her/their income restraints. A health insurance company, which has already segmented consumer-base on the basis of the study of data/evidence directly pertaining to health insurance market, offers various types of insurances. These insurances could also be co-sharing in nature, which means that portion of medical expenses is shared by individual/group/family (around 20%) the rest is paid by insurance company. Most of the population chooses health insurance on the basis of their income, which implies that income restraints influence decisions regarding the buying of particular type of insurance.

Types of Medical Insurances

From the study it is also apparent that there are three main types of insurances; Basic, Major Medical and Co-Sharing. The price fluctuates as the extension of health coverage changes. The Major Medical Insurance is an extensive health insurance, which covers the bill of medical expenses, drugs/medicine and visits to hospital. It is an expensive insurance, and individuals/groups/families, with higher income are able to afford Major Medical Insurance.

Limited Benefits are actually categorized as Basic Hospital Expenses, which are provided to an extent for a certain period. For instance, Basic Hospital Expense Coverage gives a medical coverage or endures medical expenses for not less than month, for an insured individual that is in hospital (continuously).

The Co-sharing is another type of insurance, in which an individual, group or family co-shares the expenses (medical) of an insured individual, family or group. The proportion share, of medical expenses, is determined by the insurance policy bought/chosen by family/individual/group.

Managed Care

This system is devised to manage cost, increase utility and quantity. This system is developed for such segment of society, which has low income and fewer resources, especially financial. However, managed care is complicated system and does not provide extensive coverage.

HIPPA: It is an abbreviation of health Insurance Profanity and Accountability Act. It is a legislation, which was passed in the year 1996 and became an act to safeguard medical information/data of an individual, group or family.

COBRA: Consolidated Omnibus Budget Reconciliation Act, which was signed by President Regan, gives employees the right to continue to pay for their premium, even after quitting their jobs. This allows them to keep their insurance coverage, even when they quit job.

Taxation: According to the provision, if an employer, of an organization, pay for the insurance, of an employee, his/her wife or his/her dependents, that given amount will not be considered wage and it will not be subject to Social security, Medicare and taxes such as FUTA.

References

TLD. (2016). What is MEDICAL EXPENSE INSURANCE? Retrieved October 31, 2016, from TLD: http://thelawdictionary.org/medical-expense-insurance/

Categories
help writing college papers

Paper On Calculations

Chapter 24 Problem 03

One light year = 3 x 10 8 m/s

Number of days in one year = 365.25 days/ year

Hours in one days = 24hr

Total number of second in one hour = 6omin x60 sec

= 60 x 60

= 3600 s/ hour

Distance of the star is 4.0 light years

4.0 light years can be expressed is product of speed of light in one year, total number of days in one year total hours in a day and number of seconds in day.

4.0 light years = (3600 s/ h r)

= 37869120000000000 m

= 3.7 x 1017m

Chapter 24 Problem 04

Frequency range of FM radio waves = 88.0 MHz to 108.0 MHz

Inductance = L = 2.00 x 10-7 H

Capacitance at different ranges is given as

Capacitance at min. range = Cmin=?

Capacitance at max. Range = Cmax=?

f=

f2=

Cmin=

= 0.0611

Cmin=

Cmiax=

= 0.0920

Categories
help writing college papers

Information From Speaker

Information from Speaker

Cary Caster from the 21 drops has told about the essentials of oil therapy, that how the customers can be treated in the better way and how the effectiveness can be given to the patients. However, the company is providing the healthy and a beautiful way to life to the customers; the company is treating the wide range of the customers from a headache to the heartache. The oils they are producing are high quality and effective. 100% natural oil is being made in the company so that the incredible effectiveness can be there. Oil therapy is important and can relax the body and mind.

The speaker while accessing the market of therapy oil, delivered the speech related to the professionals, however, in the speech, the guest speaker told about the marketing and the professionals, that professional are required to make the best oil. The focuses, was on the product and the packaging, that packaging should be attractive and clearly tell about the product. The speaker said they are hiring the new professional, who is experienced for the company so that the benefits can be given in the market and to the customers. The speaker shared her experience she gained from the different world, she is focused on making the product International, and the company wants to make the oil essentials, which give benefits to the customers across the world.

However, she shared about her family, that they are also researching in this field so that there could be benefits she said she get a golden chance in life when she comes to know about the oil therapy, which is given in the different countries like France. She told about the companies, which are making money in the market, by accessing the need of the customer and by giving benefit. To know about the business and the products is important so that the exact services can be given to the needy clients, shereally value her client and want to hire the people who can make the differences.

She is focused on the differences; she wants to serve the customers in the different ways; she said that there are researchers going, and interests are shown by the professionals to explore the new ways. In the packaging industry the differentiation I also being focused, the culture, traditions, and customs of the countries and people are also noticed so the product should be made according to the choice and the preferences. The company is making the framework for the evaluation that what goals is a need to achieved for the best customer services, however, imagination for the oil therapy should not be focused on need because there is the need to know about the accuracy of things. 

Speaker also said that there are the focus and approaches towards the problems, through the potentials, the vendors and problems are being focused, however; the company want to serve internationally so that the customers will be there, the effort is there to provide the best services in the market. The customers are focused so that they can be retained and given benefits for the long-term. Moreover, the company is focused on to maintain the international standards, in the other countries.

Consequently, the speaker said that there is the analysis of the current situation and the customers, to know about the advantages that they are getting. However, the customers are negotiated so that the evaluation of the products can be done, and to know about the remuneration that the products are giving to the potential customers, a company is focused on to provide the best quality to the customers.

Categories
help writing college papers

Reading Comprehension for Foreign Lawyers

Chapter 3: “As All Life Is an Experiment.”

  1. What was the 14th Amendment initially thought to protect?

The main aim of fourteen amendments was to protect all rights. It was the constitution made on July 9, 1868.It helped in granting the citizenship to all. According to this amendment, all people naturalized or born in the US in which the former slaves are also included which are recently freed. Additionally, it forbids the states from denying the person liberty, rights or property. The law for the equal protection was made. The 14th amendment was expanded the civil rights protections to the Americans. It was also cited in litigation more than any other amendment (Holmes, 2013).

  • In Patterson v. Colorado, decided in 1907, what did Justice Holmes say the main purpose of the free speech guarantee?

The main purpose of the free speech was to grant the full rights of the public and prevent the previous restraints, which were made in the publications, which is done by much past government. However, it does not prevent the punishment, which could deem the welfare of the public. The free speech is important for the liberty of the every man. These protect against the violence. It is also the 14th amendment clause, in which the persons forbade to deprive any individual of his liberty without the permission of the law.

  • Why were the dissenting opinions of Holmes and Brandeis in the freedom of speech cases between 1919 and 1929 important for American law?

According to the dissenting opinion of Holmes and brandies in the freedom of speech, in the United States v. Schwimmer, in 1929.The dissenting opinion was the first amendment guarantees are seen as very much important for the purpose of protection when there are times of upheaval and fear. Also, when there is a call for suppression is more strident as well as appealing superficially. Moreover, according to Holmes, it would be the principle of free thought when any principle related to constitution imperatively calling for the purpose of attachment compared to any other. The principle of free thought is not the free thought for those people who agree with us, but it is made the freedom for the thought, which we do not like (Lewis, 2011).

Chapter 4: Defining Freedom

  • Which state law did the U.S. Supreme Court consider in the case Stromberg v. California? Why was the Supreme Court’s decision in Stromberg important?

The court in the case of Stromberg v. California had to consider the law of red flag California in 1919.That whether it was unconstitutional under the fourteenth amendment. In the 7-2 decision, the logic of the Holmes doctrine was followed by the chief Justice Hughes that was introduced in the Scheck. It was concluded in 18 may 1931 that the ban on the red flag was seen to be vague. It may interrupt the constitutionally protected opposition that was made by the citizenry to the people who have the power. The law was repealed in 1933 by the California legislature (Ellis, Emon, & Glahn, 2012).

  • What are two examples given by the author of speech or writing that the First Amendment does not protect?

The first amendment is not responsible for protecting all types of speech. Although it does say that, the Congress shall make no law, but there are some things, which does not protect. For example, the employer may have the power of prohibiting the specific type of speech, which may not violate the person first amendment rights in the case in which the employer is not the public employer. The other example is the violation of copyright rules in which the intellectual properly is also protected as well as trademarks. Therefore, the freedom of speech cannot violate the copyright rules. The libel and slander are another examples that it does not protect the individual, which are because of civil penalties in the case of defaming another person through the verbal or Witten communication.

  • What was Minnesota’s Public Nuisance Law, and why was the outcome of the case Near v. Minnesota a victory for the American press?

The Minnesota’s public Nuisance law was made in 1925 to close the newspaper deemed obscene as well as slanderous. The decision of the court also set the national precedent, for the purpose of the censorship issues as well as for the freedom of the press. It was made due to the reaction of the personal attack, which was printed in the newspaper, so this law was made quickly. The outcome of the Near V. Minnesota was seen as the victory in the United Supreme Court decision because it helped in recognizing the freedom of the press through rejecting the restraints made on the publication. The court was for Minnesota law as it targeted the newspaper publishers and violated the rule of the first amendment (Mullen, 2015).

What questions do you have after reading these chapters? Were there concepts that you did not understand or ideas that you would like to discuss in more detail? Write down at least two questions to share with your classmates:

I do not have any question but the concept that the freedom of speech has always remained very much important in the USA always. The definition of free speech is always different for every person. The question that I would like to share with the classmates would be about their opinion on the freedom of speech and which rule that want the first amendment should not protect or protect as well.

Reference

Ellis, M. S., Emon, A. M., & Glahn, B. (2012). Islamic Law and International Human Rights Law. Oxford University Press.

Holmes, O. W. (2013). The Common Law. Courier Corporation.

Lewis, A. (2011). Make No Law: The Sullivan Case and the First Amendment. Knopf Doubleday Publishing Group.

Mullen, M. (2015). Minnesota’s Public and Private Nuisance Laws. Research Department, Minnesota House of Representatives.

Categories
help writing college papers

Alternative Energy Generation Systems and Weather

Alternative Energy Generation Systems and Weather
Electric power has become fundamental need, as it is required to power most of the devices, instruments and tools, which we use for personal, industrial and other purposes. The contemporary world, which is a consequence of social and technological advances, cannot survive and exist, as we know, without electric power. Therefore, the significance of energy resources and power generation systems has augmented radically. This is also the reason for the increased allocation of recourses, by both countries and corporations, in devising more efficient and low cost energy-generation systems.
There are two broad categories of Energy/power generation systems; conventional and unconventional. Conventional Energy resources are actually carbon-based resources, such coal and oil, which are used to generate electricity on various scales, from micro to macro. Large energy-generation systems, based on conventional resources of energy generation, can produce electric power to meet the needs of large cities.
The systems, which are identified or classified as conventional energy generating systems, are very stable and efficient. This is because these systems have been employed for an extended period, which has facilitated their evolution from less-efficient and high cost systems to more-efficient systems that are less costly than previous.
However, many socio-economists are of the view that conventional systems, of power generation, have high economic and environmental cost and these factors have the very reason for exploring and devising alternative energy systems that have less economic and environmental cost.
Alternative or Renewable energy resources are the second type, which enable power-generation systems to produce clean and inexpensive electric power. The Energy technology is very contemporary and has been employed on limited scale. As Alternative means, of energy generation, are recent; therefore, these systems are in their evolutionary phase. The unconventional energy-generation systems use renewable energy resources, such as Solar, Geo- Thermal, Tidal, Wind, Hydro etc are used for the purpose of energy/power generation.
Source: (McMahon, 2016)

Though both Conventional and unconventional resources produce energy, through energy generation systems, however, their cost and impact are very different. For instance, conventional energy systems consume such resources *(carbon-based), which are perishable resources. Because of the perishable nature of these resources, their consumption is reducing their quantity and it is projected that in the near future, less of these resources would be available at higher cost (supply and demand).
On the contrary, Alternative energy resources are renewable energy resources, which means that the consumption of these resources, for the production of electric power, does not reduce the quantity and in future, these resources would be available in same quantity and may be at lower price.
From the evidence we can presume that Alternative energy-generation systems are in their evolutionary phase, as most of these systems are not yet stable and efficient. There are numerous factors, which are contributing to the evolutionary process, of power-generation systems (alternative). For instance, in the developed countries unconventional power-generation systems are being employed at grand scale, which has increased their corporate/commercial use. Many private companies are investing their resources, financial and human, to increase the efficiency and stability of these new systems. The contemporary/evolved technology, which is being exploited to increase the efficiency and stability of these systems, has increased the confidence of states to employ these power-generating units (McMahon, 2016).
The stability, of unconventional power-generation unit, is defined as the ability of a system to produce electric power at consistent rate for a particular period. This is essential to understand that a system, which is not stable, cannot be employed to produce electric power, as the cost of instability, of the system, is immense. This is because not just individual lives are affected by irregular production and flow of electricity, but also industry is adversely affected. In many developing countries, because of the irregular generation and flow of electricity, economy is badly hurt; which slowed economic growth and reduced employment level.
Efficiency, on the other hand, pertains to both cost and functioning. A stable power-generation unit is not enough, and therefore; it must also be efficient. This means that it must be cost effective and must be able to produce at consistent rate, with little depreciation, of the unit. From the evidence we know that most of the new power-generations systems are less-stable and less efficient. Source: (McMahon, 2016).
Engineers assert that this is because the new systems have not been employed on large scale and because of that they have not evolved because of the trial and error method. However, as developed countries have started to employ these systems, for last two decades, these systems have improved. In addition to that, because of their economic and environmental benefits, large corporations are investing enormous resources to produce highly-evolved systems, which are contributing to the progress of power generation systems, run by renewable energy resources.
Weather and climate plays an important part in deciding, which type of power-generating system would be employed, in particular region, for the purpose of power generation. We have learned, from the methodical study of evidence, that to exploit particular renewable resource, a certain type of power-generation system is designed. For instance, to exploit the solar-energy, Solar panels are designed that produce clean electrical power. In these systems, photovoltaic Cells, of large size, are used to produce electricity. These are the most evolved unconventional power generation systems, as these systems can be used to produce energy at both large and small scale. The study, of solar-panels also reveals that there are two types of photovoltaic cells; crystalline silicon and Thin-film. The solar panel, which is used to produce electricity at smaller level, is connected to inverter and batteries (for the storage).
http://www.geography.learnontheinternet.co.uk/topics/climatezones.html
Unconventional energy systems, which are based on Solar Power, are usually employed in those regions, where climate is usually hot. Countries, where summers are usually longer and the duration of day is lengthier, these power generation systems are very effective. For instance, in tropical regions, solar powers systems are must be employed, as these systems would be more effective in these regions.
According to the map, regarding climate, it is plain that in Central Africa, Latin America and in Far East regions, solar panels can be employed to generate energy on all scales; macro and micro. Other alternative power-generation systems would not be effective and may not be stable for tropical regions. This also asserts how important it is to study weather and climate for the optimal generation of power, through unconventional means or renewable energy resources.
Wind-turbine systems are also being employed for the generation of electric power. However, studies on wind-turbines suggest that these systems are costly and it hard to employ them for the low scale production. The standard design of the wind-turbine consists of blades (usually three in numbers) that rotate on the rotator. These blades, with which motor is attached, are erected by a tower. The width of the blades and the size of tower give properties to the system and directly affect the production of electric power, its efficiency and stability. For instance, very small size wind-turbines are not efficient and stable and this is the very reason, why these systems cannot be employed at micro scale; to produce electricity for a house (AEN, 2016).
The above map provides information, regarding the arid regions around the world and this information facilitates countries, companies and consumers to take better decisions regarding the installing of wind-turbines. This again endorses that weather plays an important part, when decision of installing an unconventional power system is to be taken (IG, 2016).
Another commonly used unconventional mean of generating electric power is water dams. For many decades, hydro-power is being utilized to generate energy. In both developed and developing countries, hydro-power systems (dams) are being used to generate inexpensive and clean energy, at great scale. As these systems have been employed for extend period, these systems have evolved and their stability and efficiency have increased. This increased efficiency and stability has made hydro-power systems highly preferable. As these systems vary in size and they can serve other purposes too, like irrigation and water storage, these systems is usually the priority, if water resources exist.
In Asian countries, especially South Asian and Far-East Asian where there large water basins and reservoirs, hydro-power projects of various sizes are being installed to meet the requirements and needs of power. It is imperative to understand that Asian countries are generally developing countries, where population and industry are expanding; therefore, to meet energy requirements hydro resources are utilized. The methodical study of literature also reveals that there are various types of hydro-power units. The most inexpensive are runoff hydro-power units, which require less allocation resources and time; they are installed for purely power-generation purpose.
http://www.eia.gov/todayinenergy/detail.php?id=23552
The chart above reveals the current and future capacity of hydro-power generation, of South East Asian countries. It seems that most of the South Asian countries prefer to meet their energy needs through hydro-power systems. The reason for exploiting this option is that these countries have large water reservoirs, particular weather and terrain that permit them to utilize hydro-power potential (EIA, 2015).
Analysis: From the study on this subject, I have learned that both conventional and unconventional power generating systems have been employed. Most of the states, whether developed or developing, have employed unconventional power generation units for the purpose of power generation. For instance, hydro-power systems have been extensively installed to generate electricity, at different scale, at very low economic and environmental cost.
The carbon-based conventional power generation systems are not used to produce electric power at large scale, as it has enormous economic and environmental cost. In addition, the depreciation and consumption, of carbon resources, is extremely high, when these systems operate to produce energy at large or macro scale.
From the evidence it is deduced that because of advancements in the realm of technology and more frequent employment of new alternative energy systems, the contemporary unconventional energy generating units, such as solar systems-wind turbines, have evolved. As these systems are improving, their commercial application is also augmenting. For instance, Solar Panels are now designed to be more stable and efficient and they can produce energy (electric energy) at various levels. In tropical regions, solar panels can be used to provide electricity to entire city (comprehensive solar system with hundreds of solar panels) and it can be designed to power a house. This increased utility has augmented its application and sale. However, study also suggests that some systems require further development, as these systems, such as wind-turbines, are not stable and efficient.
Weather, as per analysis, plays an important part in deciding, which unconventional power system is more appropriate for the region. For instance, in the arid regions, Wind-turbines are more efficient than other systems like solar-power systems.
Generally, it was considered that most of the alternative power generation units are expensive and the economies of scale are large. However, the evidence suggests otherwise. As the evolutionary phase, of these systems, has accelerated, they have become more cost efficient and stable. As per research, alternative energy systems have started to compete, in pricing with conventional systems and it is being projected that in time to come, the economies of scale will shrink.
Conclusion
In the near and distant future, more stable and efficient energy systems will be devised and installed, as weather/climate permitted. Already countries are using various options to produce electricity, in different parts of the country, where these systems function more optimally. For instance, in countries like China and India, all unconventional methods of power generation have been employed for the purpose of generating electricity.
As the atmosphere is deteriorating, because of increased emission of carbon, it is becoming imperative to devise energy generation systems that have minimum economic and environmental cost. Another reason, for the increased emphasis on the New Power-technology, is this that resources to produce energy are renewable. The resources, used by conventional power units, are perishable; whereas the resources, used by unconventional power systems, renewable. This implies that would not affect climate and they would be cost less, in time to come. Therefore, the future is unconventional power generation systems, as they are not just in harmony with nature and fueled by climate (nature), but also they are not stable and efficient.

References
AEN. (2016). INCREASING THE EFFICIENCY OF WIND TURBINE BLADES. Retrieved October 26, 2016, from AENews: http://www.alternative-energy-news.info/efficiency-of-wind-turbine-blades/
CARDWELL, D. (2014). Solar and Wind Energy Start to Win on Price vs. Conventional Fuels. Retrieved October 26, 2016, from The New York Times: http://www.nytimes.com/2014/11/24/business/energy-environment/solar-and-wind-energy-start-to-win-on-price-vs-conventional-fuels.html?_r=0
EIA. (2015). Beyond China, other Southeast Asian countries plan for significant hydroelectric additions. Retrieved October 26, 2016, from Today In Energy: http://www.eia.gov/todayinenergy/detail.php?id=23552
IG. (2016). Climatic Zones. Retrieved October 26, 2016, from Internet Geography: http://www.geography.learnontheinternet.co.uk/topics/climatezones.html
McMahon, J. (2016). Renewable Energy Is Now Inevitable, Energy Secretary Says, Citing Price. Retrieved October 26, 2016, from Forbes: http://www.forbes.com/sites/jeffmcmahon/2016/06/03/renewable-energy-inevitable-energy-secretary-says-because-of-plunging-prices/#6d3286331ec9

Categories
help writing college papers

Rescue puppy

  1. Becker sling

Becker sling has D ring to body puppy slings. Becker sling has specifications of the marine quality resilience attach with the foam pads. Also, It has an adjustable chest of sling. Becker sling has up gradations to support the system from the body of a puppy. Becker sling has Instant release spread bar system. Further, it is design of nylon and supple. Becker sling is good for the rescue squad to evacuate the puppy from an emergency.

  • Hast rescue frames

Hast rescue frames have the capability to support the weight of animals. Hast rescue frames have built under the aluminum to support heavy weight during an emergency evacuation of puppy. It has Tripod frame is best suitable for the puppy to reuse effectively.  It reduces exhaust from padding to stay on the surface of the water in essential and adequate manner. It helps in reduce cutting clawing at the side of well during the evacuation of puppy in an emergency.

  • Water rescue harness

Water rescue harnesshelps the puppy to swim during a water rescue. Water rescue harness has puppy much like a driving SURCINGLE. Water rescue harness has a complete revision of new chest float of puppy. It has credibility with quick release catches for both girths as well as chest float. Water rescue harness has a wide amount of adjustability for many animals.

  • Puppy evacuation kit

Puppy evacuation kit helps in the creative development of rescue puppy in the best way. It is an accessible carrier for each pet.  It has a small container of oxygen to provide animals during rescue puppy in case of emergency. Puppy evacuation kit has a harness with a ring of the leash. Puppy evacuation kit has marine quality resilience attach with the foam pads. Such foam pads sustain the temperature of normal animal temperature. It helps in optimizing the puppy body in normal temperature to evacuate the puppy from an emergency.

  • Trashcan box

Trashcan box is a simple plastic box that drops down into the water to catch the animals during an emergency. It has small oxygen of box that initiates the normal temperature of the puppy during the rescue. It is made up of plastic and recycles material that provides to sustain on top of the surface of the water. It has characteristics of reduction in fames like noxious presentations in water. Such box Trashcan box required minimum 3 minutes to evacuate from the water.

Creative technique demonstrations

Thus to sum up all descriptions for rescue puppy from evacuation is required careful handling equipment for the evacuator. Five techniques explored in the paper that helps in rescue the puppy in an effective way. Becker sling and water rescue harness are the best technique to rescue the puppy.  In my point of view, water rescue harness is the best technique to evacuate puppy in case of emergency. Water rescue harness has a complete revision of new chest float of puppy as well as quick release catches for both girths as well as chest float.

Categories
help writing college papers

Sunni School of Islam

Sunni School of Islam

General Geographic Distribution

Sunni schools of Islam is one the biggest division and group of people in the Islamic world.  It is consist of different schools of law, and these are Malikiyyah, hanafiyyah, Shafiyaah, hanbaliyyah (Hughes, 2013).The geographic representation is interesting because the people associated with Sunni schools of Islam are living in every part of the world. According to the sources, people who are associated with Sunni Islam are around 90 percent of the Muslim Population. The country of Afghanistan and Azerbaijan are the prominent areas with Sunni schools of thought.  On the other hand, it is imperative to understand that around 80 to 90 percent countries of the Muslim world are fraught with Sunni Muslims. 

Differences & Characteristics

In the Middle East, there are other two major religions is in practice. The followers from Judaism and Christianity are in low numbers. A major group of Christian is Coptic speaking and around 5 percent Christian community is recorded in the Middle East. They are in less number due to the low level of birth rate as compared to Muslims and they have been immigrating as well (Malik, 2013). On the other hand, the Judaism religion has been practicing in the Israel for years. According to reports, around 75 percent of people are practicing Judaism in Israel. Sunni schools of Islam are quite different from Judaism and Christianity in the Middle East.  

Politics

It is imperative to understand that Sunni schools of Islam have the significance role in Islamic countries and politics as well. On the other hand, the Sunni Schools of Islam is practicing in large number in Afghanistan, Azerbaijan, Bangladesh, Pakistan, Saudi Arabia, and Indonesia.  All of these countries are performing their way of ruling and politics. One would analyze the different electoral or political system of these biggest countries in Sunni Schools of Islam.

Elections and Political Objectives

Most of the biggest countries associated with Sunni Schools of Islam have the stable political conditions. First, the kingdom of Saudi Arabia has the system of monarchy, and it is totally opposite to the system of democracy. The democracy has been in practice in most of the countries in Sunni School of Islam, and these are Bangladesh, Pakistan, Afghanistan, and Azerbaijan. These countries have the objectives to increase the role of Sunni Islam in the betterment of Islam and humanity as well. Also, the political objectives are too stable the conditions of the country to increase the economy growth and human capital.

Recent Successes

It is a fact that Sunni Schools of Islam or Islamic world is not progressing as expected due to some serious issues and fights in major countries. Anyhow, the countries associated with Sunni Schools of Islam still progressing and overcoming the economic or sustainability issues.  The country of Turkey is progressing in economy Growth, and people from Turkey are happy from their leadership.

On the other hand, the country of Pakistan is also associated with Sunni Schools of Islam. They are getting the victory against the terrorism factor working in Pakistan. Through the mission of “ZARB E AZB”, the military of Pakistan is getting success at high levels in different regions (Ghazanfar, 2016). Therefore, it is an obvious thing that Sunni Schools of Islam and countries linked to it getting successes on different Grounds and will grow in the future.

Map

Madhhab_Map3.png

Source: https://upload.wikimedia.org/wikipedia/commons/4/44/Madhhab_Map3.png

Reference

Ghazanfar, S. (2016). Operation Zarb-e-Azb: Two years of success. Retrieved October 25, 2016, from THE NATION: http://nation.com.pk/national/06-Sep-2016/operation-zarb-e-azb-two-years-of-success

Hughes, A. W. (2013). Muslim Identities: An Introduction to Islam. Columbia University Press.

Malik, H. C. (2013). Islamism and the Future of the Christians of the Middle East. Hoover Press.

Categories
help writing college papers

Competitive Position of Coffee Shop at University of Oregon, Eugene, Oregon

Competitive Position of Coffee Shop at University of Oregon, Eugene, Oregon

The coffee shop at the University of Oregon is the only coffee shop within the university campuses, therefore, within the University; the competitive position of the business is very successful as there is no internal competitor for the University.  Likewise, the of the Coffee Shop with the comfortable environment with the facility of the book store and Wi-Fi within the university campuses is a unique idea which is not found anywhere near the university or even within the city. However, there are some coffee shops in the surrounding that could be considered as external competitors of the company but at the current stage, the coffee shop business has no threat from such coffee shops because company is under contract with the university and no one else will start its coffee business within the campus of the University of Oregon at the location of Eugene, Oregon.

There are various coffee shops are running their business in Eugene Oregon which sets a product competition for the Coffee Shop at the campus of University of Oregon, Eugene, Oregon. Following are some of the potential competitors:

Competitive Coffee Shops at Eugene Oregon

Theo’s Coffee House is the most famous Coffee Shop business running in Eugene, Oregon as it is running 18 café within the city

Wandering Got Coffee Co.

Vero Espresso

Coffee Plant Roaster

Crum Together

Town Shend’s Eugene Teahouse

Tailored Coffee Raosters

Full City Café

Interestingly none of these competitors are running their business with the same idea of offering a comfortable, silent environment to study and to enjoy coffee together.

Competitive Edge

Coffee Shop at the campus of the University of Oregon has a competitive edge over the other university which is the idea of the business to offer coffee in a comfortable environment which is up to the need of the target market. However, there are many famous coffee shops are running in the surroundings of the university but none of them are offering such a comfortable environment along with coffee that allows students to study and enjoy coffee together.

Another competitive advantage for the university is that it does not have to invest huge on marketing to target its customers because all the students and the staff of the University are the customers of the coffee. Moreover, there is another describable competitive advantage for the Coffee Shop at the the University of Oregon as there is no other place within the university where a competitor could force the coffee shop to share its customers. Moreover, to overpower the competitive threat in future as well as to expand the business, the companies is looking forward to signing a contract with the company which will make the university not to let another brand start coffee shop within the university, but this contact will be on conditions. 

Market Share Distribution

Interestingly, at the current stage, the company does not have to share its target customers with any of its competitors because the university does not have enough space to let any other company to start its business within the university. Moreover, the entire target market of the coffee shop are the students, teachers, and staff members and they do not have any other option or alternative to such facility. Therefore, they are bound with the coffee shop at their campus.

Moreover, the students have to spend a particular time within the university, therefore, at that particular time they found Coffee shop within the campus as the best option to enjoy coffee and do their readings together. Subsequently, for the Teachers and the staff, there is no better option than coffee shop within the Campus to get relax and to get prepared for the lecture.

Future Competition

The threat of the new entrant always exists in the market, but at the current stage, there is no future competition threat for the Coffee shop. The there major reason behind this is the unique business strategy. At the current stage, there is hardly any other company that is working with this unique idea.

Secondly, there are huge barriers for the new entrants. Most of all are that there is not enough space inside the university to start another coffee shop. On the other hand, in case if the company starts the business in near around the university, then the next challenge will be the environment because the coffee shop does not only have its worth for its product but at the same time it is a great tie of right product at the place for the right people.

In case if a company attempted to do so, then it required a large area of property which means huge investment. Moreover, even after the huge investment, there will be no surety whether the student or teacher will go to the coffee shop. It is not because while sitting at the coffee shop within the campus allows students to go to their lecture rooms in no time, therefore, they will feel more comfortable to enjoy coffee at the shop within the campus instead of going to outside.

Strategic Position and Risk Assessment

The purpose of the Coffee shop at the initial stage is to target all the students and staff of the university in which it seems very successful as the business is up to the need and demand of the target market, as well as there is no other option available for the target market.  Secondly, the agreement with the university gives great protection to the business. Moreover, the tie of the right product at the right place for the right people is the strongest strategic factor for the business.

However, to expand further, the companies needs to sign a contract with the University not to allow any other brand to stat its business but for this aspect, there is a need to maintain the standard and the quality of the product and services.

Overall, the strategic position of the coffee shop business is very strong, and it also has very low future competition threat as the entry barriers are huge for the new entrants and they have to manage various things which required a huge investment.

Industry Trends and Opportunity

There are great opportunities for this unique business because the university is also aimed to expand its campuses; therefore according to the contract new shop could be open at new campuses. Subsequently, there are other options available such as the company can also make a contract with other universities and start its shop at other university campuses.

Categories
help writing college papers

Assisted Reproductive Technologies

Comparison of genome-wide and gene-specific DNA methylation between ART and naturally conceived pregnancies

Oval: DNA methylation

Concept Map

Significance of cord blood vs. placental

Cord blood is the name of different cells, which are very necessary for the blood production and circulation in the body.  In other words, experts have mentioned it as a blood taken from the body of a newborn baby in order to examine the umbilical cord. Therefore, the significance is quite relevant to the subject and content of the article. It is slightly important in some cases and not much important in few cases. On the other hand, the placental has great significance in few clinical processes. It is imperative to understand that it has the crucial part and important role in the process of pregnancy. According to experts, the placental has the power and impact to keep the baby alive in the period of pregnancy. Therefore, one can say that both concepts have their own importance and significance.  

What can be learned from genome-wide approach vs. specifically targeted genes?

The genome-wide approach is an important aspect in DNA methylation and one can learn many things from this particular approach. It is the approach, which is quite useful in the process of the DNA and linked operational activities.  It is very beneficial in the case-control setup In the process of DNA methylation. The human genomic research made it very necessary and significant in the studies of the DNA and associated programs and processes. On the other hand, the second approach is specifically targeted genes and it has its own significance in the DNA methylation.   One can understand from the name of the concept that it is targeted concept for the targeted result. It is very useful for specific and targeted function.  It is not wide approach like genome-wide approach in order to get specific results.  Anyhow, both approaches have their own importance and significance and experts are acknowledging the fact.  In the concept of DNA and conceived pregnancies, both of the approaches are useful and these concepts have their own significance and importance in the field of plants or any other field.  In addition, it is a genetic technique as well for the better results from different assumptions from experts. In this context, one can understand the significance of the CPG sites as well. According to the paper, “CpG sites located on the sex chromosomes were excluded from the analysis”.  It is the clear indication of the importance of above-mentioned concepts in this field.  

Categories
help writing college papers

Introduction to Bioinformatics

Introduction to bioinformatics

  1. What are the three major components of a nucleotide?
  2. Phosphate
  3. Sugar
  4. One of four bases (Thymine, Guanine, and Adenine, Cytosine)
  5. Nucleotides are subunits of what biological macromolecules?

Ribonucleic acid and Deoxyribonucleic acid are the subunits of nucleotides of biological macromolecules.

  • Amino acids are subunits of what biological macromolecules?

Carboxyl groups, Central carbon, Lipids, Proteins are subunits of amino acids of biological macro molecules.

  • Consider the following DNA strand.

5′-ATGAAAGAGAAGATGTTCAAAAGAAAACATTCACAAAATGGGTAAATGCACAATTTTCTAAG-3′

a) What is the complement of this strand of DNA? Be sure to label the 5′ and the 3′ ends of your answer.

Sample DNA

In discussion of sample DNA results reveals the following

5-

>sampled sequence 1 consisting of 100 bases.

TATCTTAAATATCTAAAACTAGTACACAAAATTTGACAAATAAAATAATGAAATTGTCGTGTATTGGTAAGATGATATTATCATATGAAACACATATGCA-3

b) What is the reverse complement of this strand of DNA? Be sure to label the 5′ and the 3′ ends of your answer.

3->sampled sequence 1 consisting of 100 bases.

ATCATAATAGTAGACAATAATAATAAAAAAGATACTAAAGACTTGATTAAAATAATCAAATGAGTTAAAATAAGATAAGAAATAAATGATAAGTACTCAA-5

  • What are the two basic categories of nitrogenous base that make up nucleotides?

Cytosine and Thymine are two basic categories of nitrogen that make up of nucleotides

  • Determine the primary structure (i.e., the sequence of amino acids) of the protein fragment that would be translated from the following RNA segment in the +2 and -2 reading frames. Use a star, *, to indicate a stop codon. Express the protein fragment using both one- and three-letter codes. 5′-AUGCAUCUGGAGGGCAGAGACGGCAGGCGGUACCCCGGCGCGCCGGCGGUGGAGCUCCUG-3′

Filter Protein results

>filtered protein sequence consisting of 53 residues.

AGCACGGAGGGCAGAGACGGCAGGCGGACCCCGGCGCGCCGGCGGGGAGCCCG

Random Protein Sequence results

>random sequence 1 consisting of 2 residues.

VP

Protein Pattern Find results

Results for 53 residue sequence “Untitled” starting “AGCACGGAGG”

no matches found for this sequence.

7.  What is the result of the following processes during the information processing of DNA?

a) Transcription

The process of transcription with the information of DNA strand recognized into molecule of messenger RNA. The DNA is stable and safe strong the material of genetics with the nuclei cell that freely exist in the nucleus. The MRNA has same information that DNA contains.

Translation

b) Translation

During translation, gene expression is the major step that read MRNA genetic code related to the sequences of DNA towards amino acid sequence in proteins. It constitutes condon MRNA, that each condon has particular amino acid which is called triplet code.   The sequence of MRNA is template to assembling chain of the amino acid in the form of proteins.

  • Besides replacing thymidine (T) with uracil (U), name two other structural features that make RNA different from DNA.

Development of hydroxyl group with two positions of sugar ribose and group of phosphate structure is to make RNA charge molecule which is called polyanion. Such polyanion have two structure features that make RNA.

  • The primary cause of the genetic disease cystic fibrosis is a three-nucleotide deletion in the gene that encodes a protein called the cystic fibrosis transmembrane conductance regulator (CFTR). However, the disease can also be caused by a single nucleotide mutation (one nucleotide changed into another) in this gene that results in a premature stop codon.

ORFs found: 1 Genetic code: 1 Start codon: ‘ATG’ only

ORFs were calculated on the interval from 3000 to 4000 nt

Label Strand Frame Start Stop   Length (bp | aa)

ORF1  +          3  3006            >3998  993 | 330

  1. What is the difference between a reading frame and an open reading frame (ORF)? Make up a 10-codon long example of each. Do not copy anything directly from a textbook or the Internet.

The reading frame provides the figures and values but unable to understand the core aspects in the reading frame to obtain adequate answers. On the other hand, open reading frame helps in understanding of ORF’S in sequence of DNA. It provides protein translation with each range of ORF program returns. Using ORF search protein potential in DNA encoding segments supports IUPAC alphabets as well as several genetic codes to obtain required results.

ORF Finder results

Results for 93 residue sequence “sample sequence” starting “gcggcggcgg”(by 10 condon long example)

>ORF number 1 in reading frame 1 on the direct strand extends from base 1 to base 93.

gcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcg

gcggcggcggcggcggcggcggcggcggcgtaa

>Translation of ORF number 1 in reading frame 1 on the direct strand.

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*

  1. Use the NCBI ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder) to do the following:

a) Find the longest open reading frame (ORF) in the sequence in the file NM_000517.fna

(contains the sequence of the human gene hemoglobin, alpha 2) on Blackboard. Use a screen shot of the ORF Finder as your answer.

b) Determine the reading frame on which the ORF resides, the start and stop positions of the ORF and the total length of the reading frame (in bp).

c) Calculate the length of the protein that would be generated from this ORF.

12. Consider the polypeptide structure below.

a) Place an oval around the amine end of the polypeptide.

b) Place a square around the carboxyl end of the polypeptide.

c) Place triangles around the peptide bonds.

d) Place small circles around the side chains in the polypeptide.

  1. Search the Entrez Gene database at the National Center for Biotechnology Information

After putting proteins in the gene codes that provide specific information on the websites that consolidated in comprehensive manner. The EGFR recognized as ID: 1956, descript in the form of epidermal growth factor receptor, dominating the characteristics of Homo sapiens specifically in humans. The name of location recognized as chromosome 7, NC_000007.14 (55019032…55207338). The name of aliases formed as ERBB, NISBD2, ERBB1, HER1, PIG61 and mENA.  The number of MIM is 131550.

  1. Search the Entrez Gene database for the gene PHYH in humans

By entering gene PHYP in humans, it reveals different results towards exons in the genes and location of chromosome as well. The name or gene ID is PHYH ID: 5264. The description of PHYP in humans recognized as phytanoyl-CoA 2-hydroxylase specifically dominated in the Homo sapiens in the human. The location of the chromosome 10, NC_000010.11 (13277796..13300130, complement) recognized in essential and adequate manner. The aliases recognized as LN1, PAHX1, LNAP1, PHYH and RD. The number of MIM is 602026. The exon count is 10. The primary source of PHYH phytanoyl-CoA 2-hydroxylase is HGNC: HGNC:8940.

  1.  In an electrophoresis experiment, why does DNA move through the gel matrix when an electric field is applied?

The execution of electrophoresis gel is a method of analysis and separation of macromolecules that includes proteins, RNA as well as DNA. Such macromolecule includes fragments which are based on the charge and size as well. The molecules of nucleic acid defined separately by applications of the electric field to move the negative molecules of charged. Such molecules of the electric charged through a matrix of agarose. The electrophoresis specifically enabling distinguish of fragments of DNA for different lengths.  DNA is negative charge, thus the electric current applied to the gel that migrate the DNA for the positive charge electrodes.

  1.  In an electrophoresis experiment, would you expect DNA pieces of a given size to move faster or slower in a gel with a lower percent of agarose? Why?

The shorter strands of DNA moving quickly through the gel as comparison to longer strands that gives fragmented in arranged order of size. DNA markers have fragments with known lengths run through the gel that reveals same time as the samples. Higher the concentration of agarose is revealing denser the matrix and vice versa. The DNA small fragments separated with higher concentration of agarose that whilst molecules require lower concentration of agarose.

  1. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane in the gel shows a digest with BamHI only?

Gel lane III shows digest with the BamHI, because it determines the number and sizes of the fragments produced with the each given enzymes. Kilobases are the “kb” stands.

  1. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane in the gel shows a digest with EcoRI only?

Gel lane II shows digest with the EcoRI only.  

  1. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane in the gel shows a digest with both EcoRI and BamHI?

Gel lane IV shows a digest with both EcoRI and BamHI.

  • As shown below a segment of DNA has two restriction sites–I and II. When incubated with restriction enzymes I and II, three fragments will be formed—a, b, and c. Which of the following gels produced by electrophoresis would represent the separation and identity of these fragments?

The option B is correct. The fragments recognized as decreasing order in the size such as c,a,b. On the other hand, recalling charging of DNA negatively as well as loading into the wall demonstrated at the negative end of electrode. The answer C also recognized as correct sequence answer because in it showing the migration in direction of wrong. 

Extra credit

Step 1: Creating a segment of DNA

Step 2: Putting 500 codon open reading frame flanked

Step 3: Minimal ORF length 75 nt

Step 4: Genetic code (Standard)

Step 5: ORF start codon to use ( “ATG” only)

Step 6: In last, ignore nested ORF’s

Categories
help writing college papers

Explanation of Marxist terminologies

  1. Proletariat

            The term Proletariat refers to the class of wage earners. They are those people in a capitalistic civilization, where only means of material value or earning is labor power. Every member of such class is known as Proletariat.

  • Bourgeoisie

            Marxist philosophy describes the Bourgeoisie as the social class owns the resources of production in today’s era of modern industrialization and the value of the property and the preservation of capital are the major societal concerns.  The reason behind is to ensure their economic supremacy in the society.

  • Superstructure

            In Marxist theory, the base and the superstructure are the two main parts of the human society. The base enforces the relation of production such as employee and employer work conditions and division of labor.

  • Substructure/base

 On the contrary, in Marxist theory, the superstructure part include the institution, culture, political power and alike. 

  • False consciousness

            It’s a term used in the Marxist philosophy that ideological, material and institutional processes in a capitalist societies mislead the proletariat members of the society and other class of actors.

  • Labor vs. work.’

            It is a crucial conceptualization used by the Marx.Labor vs. work is a component of capital which acts as a function of capital. Both the labor and their work is the real power that leads to the development of the societies.

  • Alienation

 This is a theory of Karl Marx’s. It describes the estrangement of people in the societies from the aspects of their Gattungswesen which is an outcome of the living in a society of social classes that are stratified.

  • Exploitation

            Exploitation theory of the Karl Marx describes that the labor of workers which is unpaid is the decisive source of profits behind the production of capital.  Thus, the exploitation is the base stone for the system of capitalism.

  • Labor theory of value

            This theory argues that economic value for goods and services are exclusively determined by the total socially necessary labor which is required to produce products and services.

  1. Dictatorship of the proletariat

            This theory describes that dictatorship of proletariat refers to a state in which the working class has the real political power and run the matter of the state.

Categories
help writing college papers

Race and Social Construction

Importance of diversity in shaping life experiences

Score: 3

There is the diversity of people in this world. People are divided into different groups, and these groups are called the races of the people. People have different colors, shape of eye, hair, nature, height, etc. Diversity is important for shaping the life and experiences of different people at different stages of the life. Diversity is not only important at the micro level but it is also important at macro and large level for shaping the life. Diversity helps in the changing the behavior of the people at different places. When we go to the school, we face different people. Few are white, few black, tall, small, etc. Diversity helps in the development of the children at a micro level. Their growth starts at the initial level in the schools. It is also important at the macro level.

Diversity and differences in the race of the people help in shaping their personal identities of the people. Diversity dimensions can be understood by the intersectionality of different factors like class, group, age, expression, identity, gender, status, marital status, race, political ideology, ethnicity, religion, sex, sovereign status, etc.  It is believed that due to differences in all of these characteristics include operation, alienation, marginalization, poverty, etc. Other lives experiences include at macro level include acclaim, power, and privilege. IT is important for their whole life.

Diversity also includes differences in the culture of the people. Culture also helps in shaping the behavior and future life of the people. Differences in the norms and values of the people are important for creating the power and privilege of the people. Diversified work force can be used to engage in the competition of the projects. Companies used diversity as one of the important things for enhancing the performance of their business. This is the diversity that results in the differences in the power of the people. It results in enhancing skills and practices of different people t different stages of their life

Diversity and differences in races are also playing an important role at national level in discriminating people. It is important to note that most people are discriminated when they search for a job. Sex differences are important for job searching. Most of the employers believe that certain type of job is limited for male and certain jobs are limited for boys. Physical demanding jobs are mostly associated with the male sex. Discrimination based on the wage rate is also the concern with the race.

 In America, black people are mostly given less important as compared to the white Americans. They are discriminated on their jobs due to their personal identity and presence. It is evident from the video that race is not biological, but it is differences in the physical appearance and culture that shape the life.

Q2

C. Apply Self-awareness & Self-regulation:

Score “3”

There is no question about the diversity and differences in the human races. The classification of the people is based on various characteristics; it can be age, skin color or any other characteristics. The race classification is based on the concept that the humans are classified not only physical properties but also is based on differences, which are genetically present like the athletic or intellectual ability. However, the researchers have found that the idea of race is not biological. It is much like the paradigm shift, which was needed in the perception of the earth being round and not flat.

The video shows this by various perceptions which the Americans believe to be true about their races which do not have any biological foundation. The differences in the people are natural and a fact in the human environment. However, this is not the genetical differences. It is evident form the fact that only one of the thousands of the DNA strands is different in two individuals. Therefore, this shows that the evident differences are an only small amount of differences, which are highlighted and maximized in our perception.

Basing our scoring criteria on this conclusion that the differences in the people are only the smallest of differences among us and it is not biological, we can be conscious and self-aware of the biases and influences that we usually have by the perceptions that we had about the racial differences. Through getting self-aware, we need first to fully get aware of the fact that “Race is not biological.” Also, we human beings are the most similar to organisms based on genetical composition. It can be explained by the example of the group of penguins. The penguins all look alike to us, while they may have more difference in themselves as compared to humans. Therefore, we, humans are focusing on these smallest of differences.

By getting awareness about the wrong perception about this biological racism, we can then work on self-regulation for managing our biases and influences to manage better the various clients and constituencies belonging to the diverse communities.

Having this, the mindset will allow us not to apply the perceptions that we have about various races. Like we might think that black people (as our clients) usually would be the ones who would need more understanding and briefing for us, as the perception about them is that they lack in intellectual understanding. If we were self-aware of these biases, we would not apply this perception on our clients. The scoring, therefore, would be “3” as it meets the expectation.

Source: https://www.youtube.com/watch?v=BRxZJ5QQ-9Q

Categories
help writing college papers

Introduction to Bioinformatics

Introduction to bioinformatics

  1. What are the three major components of a nucleotide?
  2. Phosphate
  3. Sugar
  4. One of four bases (Thymine, Guanine, and Adenine, Cytosine)
  5. Nucleotides are subunits of what biological macromolecules?

Ribonucleic acid and Deoxyribonucleic acid are the subunits of nucleotides of biological macromolecules.

  • Amino acids are subunits of what biological macromolecules?

Carboxyl groups, Central carbon, Lipids, Proteins are subunits of amino acids of biological macro molecules.

  • Consider the following DNA strand.

5′-ATGAAAGAGAAGATGTTCAAAAGAAAACATTCACAAAATGGGTAAATGCACAATTTTCTAAG-3′

a) What is the complement of this strand of DNA? Be sure to label the 5′ and the 3′ ends of

your answer.

Results for 62 residue sequence “Untitled” starting “ATGAAAGAGA”

>match number 1 to “ctt[ca]” start=59 end=62 on the reverse strand

CTTA

>match number 2 to “ctt[ca]” start=9 end=12 on the reverse strand

CTTC

b) What is the reverse complement of this strand of DNA? Be sure to label the 5′ and the 3′

ends of your answer.

3′-CTTAGAAAATTGTGCATTTACCCATTTTGTGAATGTTTTCTTTTGAACATCTTCTCTTTCAT-5′

  • What are the two basic categories of nitrogenous base that make up nucleotides?

Cytosine and Thymine are two basic categories of nitrogen that make up of nucleotides

  • Determine the primary structure (i.e., the sequence of amino acids) of the protein fragment that would be translated from the following RNA segment in the +2 and -2 reading frames. Use a star, *, to indicate a stop codon. Express the protein fragment using both one- and three-letter codes. 5′-AUGCAUCUGGAGGGCAGAGACGGCAGGCGGUACCCCGGCGCGCCGGCGGUGGAGCUCCUG-3′

Filter Protein results

>filtered protein sequence consisting of 53 residues.

AGCACGGAGGGCAGAGACGGCAGGCGGACCCCGGCGCGCCGGCGGGGAGCCCG

Random Protein Sequence results

>random sequence 1 consisting of 2 residues.

VP

Protein Pattern Find results

Results for 53 residue sequence “Untitled” starting “AGCACGGAGG”

no matches found for this sequence.

7.  What is the result of the following processes during the information processing of DNA?

a) Transcription

The process of transcription with the information of DNA strand recognized into molecule of messenger RNA. The DNA is stably and safely storing the material of genetics with the nuclei cell that freely exist in the nucleus. The mrna has same information has DNA contains.

Translation

b) Translation

During translation, gene expression is the major step that read mrna genetic code related to the sequences of DNA towards amino acid sequence in proteins. It constitutes condon MRNA, that each condon has particular amino acid which is called triplet code.   The sequence of MRNA is template to assembling chain of the amino acid in the form of proteins.

  • Besides replacing thymidine (T) with uracil (U), name two other structural features that make RNA different from DNA.

Development of hydroxyl group with two positions of sugar ribose and group of phosphate structure to make RNA charge molecule which is called polyanion are two structure features that make RNA.

  • The primary cause of the genetic disease cystic fibrosis is a three-nucleotide deletion in the gene that encodes a protein called the cystic fibrosis transmembrane conductance regulator (CFTR). However, the disease can also be caused by a single nucleotide mutation (one nucleotide changed into another) in this gene that results in a premature stop codon.

ORFs found: 1 Genetic code: 1 Start codon: ‘ATG’ only

ORFs were calculated on the interval from 3000 to 4000 nt

Label Strand Frame Start Stop   Length (bp | aa)

ORF1  +          3  3006            >3998  993 | 330

  1. What is the difference between a reading frame and an open reading frame (ORF)? Make up a 10-codon long example of each. Do not copy anything directly from a textbook or the Internet.

The reading frame provides the figures and values but unable to understand the core aspects in the reading frame to obtain adequate answers. On the other hand, open reading frame helps in understanding of ORF’S in sequence of DNA. It provides protein translation with each range of ORF program returns. Using ORF search protein potential in DNA encoding segments is that supports IUPAC alphabets as well as several genetic codes.

ORF Finder results

Results for 93 residue sequence “sample sequence” starting “gcggcggcgg”(by 10 condon long example)

>ORF number 1 in reading frame 1 on the direct strand extends from base 1 to base 93.

gcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcg

gcggcggcggcggcggcggcggcggcggcgtaa

>Translation of ORF number 1 in reading frame 1 on the direct strand.

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*

  1. Use the NCBI ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder) to do the following:

a) Find the longest open reading frame (ORF) in the sequence in the file NM_000517.fna

(contains the sequence of the human gene hemoglobin, alpha 2) on Blackboard. Use a screen shot of the ORF Finder as your answer.

b) Determine the reading frame on which the ORF resides, the start and stop positions of the ORF and the total length of the reading frame (in bp).

c) Calculate the length of the protein that would be generated from this ORF.

12. Consider the polypeptide structure below.

a) Place an oval around the amine end of the polypeptide.

b) Place a square around the carboxyl end of the polypeptide.

c) Place triangles around the peptide bonds.

d) Place small circles around the side chains in the polypeptide.

  1. Search the Entrez Gene database at the National Center for Biotechnology Information

After putting proteins in the gene codes that provide specific information on the websites that consolidated in comprehensive manner. The EGFR recognized as ID: 1956, descript in the form of epidermal growth factor receptor, dominating the characteristics of Homo sapiens specifically in humans. The name of location recognized as chromosome 7, NC_000007.14 (55019032…55207338). The name of aliases formed as ERBB, NISBD2, ERBB1, HER1, PIG61 and mENA.  The number of MIM is 131550.

  1. Search the Entrez Gene database for the gene PHYH in humans

By entering gene PHYP in humans, it reveals different results towards exons in the genes and location of chromosome as well. The name or gene ID is PHYH ID: 5264. The description of PHYP in humans recognized as phytanoyl-CoA 2-hydroxylase specifically dominated in the Homo sapiens in the human. The location of the chromosome 10, NC_000010.11 (13277796..13300130, complement) recognized in essential and adequate manner. The aliases recognized as LN1, PAHX1, LNAP1, PHYH and RD. The number of MIM is 602026. The exon count is 10. The primary source of PHYH phytanoyl-CoA 2-hydroxylase is HGNC: HGNC:8940.

  1.  In an electrophoresis experiment, why does DNA move through the gel matrix when an electric field is applied?

The execution of electrophoresis gel is a method of analysis and separation of macromolecules that includes proteins, RNA as well as DNA. Such macromolecule includes fragments which are based on the charge and size as well. The molecules of nucleic acid defined separately by applications of the electric field to move the negative molecules of charged. Such molecules of the electric charged through a matrix of agarose. The electrophoresis specifically enabling distinguish of fragments of DNA for different lengths.  DNA is negative charge, thus the electric current applied to the gel that migrate the DNA for the positive charge electrodes.

  1.  In an electrophoresis experiment, would you expect DNA pieces of a given size to move faster or slower in a gel with a lower percent of agarose? Why?

The shorter strands of DNA have quickly more demonstrated through the gel then the longer strands in the fragmented results.   The marker of DNA associated with the fragments of known lengths that gives run through the gel at the same time. Higher the connection of argarose , it denser the matrix, while the smaller fragments  of the DNA  separated with the high concentration of the argarose, that have larger molecules in  with the low concentration of agarose. 

  1. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane in the gel shows a digest with BamHI only?

Gel lane III shows digest with the BamHI, because it determines the number and sizes of the fragments produced with the each given enzymes. Kilobases are the “kb” stands.

  1. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane in the gel shows a digest with EcoRI only?

Gel lane II shows digest with the EcoRI only.  

  1. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane in the gel shows a digest with both EcoRI and BamHI?

Gel lane IV shows a digest with both EcoRI and BamHI.

  • As shown below a segment of DNA has two restriction sites–I and II. When incubated with restriction enzymes I and II, three fragments will be formed—a, b, and c. Which of the following gels produced by electrophoresis would represent the separation and identity of these fragments?

The option B is correct. The fragments recognized as decreasing order in the size such as c,a,b. On the other hand, recalling charging of DNA negatively as well as loading into the wall demonstrated at the negative end of electrode. The answer C also recognized as correct sequence answer because in it showing the migration in direction of wrong. 

Extra credit

Step 1: Creating a segment of DNA

Step 2: Putting 500 codon open reading frame flanked

Step 3: Minimal ORF length 75 nt

Step 4: Genetic code (Standard)

Step 5: ORF start codon to use ( “ATG” only)

Step 6: In last, ignore nested ORF’s

Categories
help writing college papers

Solar Heating Plan for Any Home

Question No 1.

Ans

The collector panels collect the heat through exposure to the sunshine. This heat energy is stored and added in the storage tanks. When the heat is needed, hot water from the storage tank is transferred to the house through an underground pipe to the radiant floor heating system.

Question No 2.

Ans

  1. No new space is required for accommodating a large thermal storage tank in this system.
  2. The collector panels can be titled as per the need for maximum solar collection.
  3. The collectors are mounted at the level of the ground, making them easy to build and maintain.

Question No 3.

Ans

For reducing the heat loss through the pipes which carry the hot water into the house, the collectors should be build as close to the house as possible. Furthermore, the pipes should be insulated well enough. Moreover the trench should be deep this much that the pipes are well below the frost line of your area.

Question No 4.

Ans

The radiant flooring is the type of flooring which is used to supply heat direct to the floor. This is done through radiant heat transfer, i.e. through infrared radiations from hot surface to the people and objects within the room.

Question No 5.

Ans

Other than the shed to have a south wall, the shed needs to be large enough to provide you with the collector area.

Question No 6.

Ans

The storage tank is large enough to store the sunshine worth about one sunny day. Through this, on a sunny day, the storage tank would be able to store energy for heating the house for all the night and even part of the next day also, if it is still cloudy.  The tank is designed to hold about 4000 pounds of water in it.

Question No 7.

Ans

8.3 Pounds = 1 Pound

4000 Pounds =

Question No 8.

Ans

The saving on propane is about 340 gallons per year that is worth of about $740 in monetary terms.

Question No 9.

Ans

The owner learned that it would be more effective to use vertical solar collector panels instead of the tilted panels used usually which are tilted at an angle of 70 degrees. This is because of the fact that the solar collector would not overheat in the summer because of less exposure to the sunshine, and not collect much snow during the time of snowstorms. This is effective because it would also not affect the amount of energy collection as well.

The other thing which the owner learned from his experience with the solar system about the collector panels is that the users should build a small overhang with a gutter on the top of the collectors so that gutter would prevent the snow to melt down to collector glazing.

Categories
help writing college papers

Economies Current Events: Discussion Form Project

Economies Current Events: Discussion Form Project

  1. A local or global issue affecting Vancouver’s economy. Example, Vancouver’s high house price or economic impact of tourism and bike lane on Vancouver’s economy.

Date of Publication: 27 April 2016

Website/ Name of news Print: Local News

Title: Metro Vancouver residents still need highest “Living Wage” in B.C

Source: http://vancouversun.com/news/metro-vancouver-residents-still-need-highest-living-wage-in-b-c?__lsa=3e6f-498e

Author: Kim Pemberton

Economic concept covered: Living Wage

Summary of article:

The author Kim Pemberton, in the article Metro Vancouver residents still need highest living wage, have discussed about the families that the families living in the Vancouver, are required maximum money, to support the families or the children, everything is expensive over there, especially in the Vancouver, it is difficult or expensive for the families to afford their children. The school fees are so high, the advantages of the government are there, but still there is the need to do expense if one wants to give the better lifestyle to the children. However, both parents have to work and earn well in the Vancouver, if the family wants to meet the good life standard. There are the economic benefits, but continuous rising in the prices are affecting the lives of the people, there are the benefits for the children in the economy. The Canada Child Benefits are there, childcare and housing cost are very much for the metro Vancouver; metro Vancouver has increased by the 61% as compared to the previous year, and expected to be rise more, which is against the people budget. The government need to take steps to reduces the prices for the people, so that the benefits can be there, as the shelter and transportation cost is continuously increasing and there can be problems if it still continuous, the economy of the country may have to suffer, however, the continuous increase in the prices, are creating troubles for the people. To afford the shelter is not easy in Vancouver, as the prices are going higher (PEMBERTON, 2016).

  • An economic issue affecting British Columbia economy. Example, the economic impact of the Northern gateway pipeline in BC and the rest of the Canada.

Date of Publication: 20 October 2016

Website/ Name of news Print: Pacific standards

Title: The Economic Impact of Climate Change on Global Fisheries Could Be Even Worse Than We Thought

Source: https://psmag.com/the-economic-impact-of-climate-change-on-global-fisheries-could-be-even-worse-than-we-thought-b719fc9221f1#.lz0hzo99r

Author: Mike Gaworecki

Economic concept covered: Climate Change

Summary of article:

The author Mike Gaworecki have discussed the economic impact of climate change, in the news article as he has mentioned, that if there are continuous changes in the climates than economic issues can be the rise in the economy. As there could be storms and other issues created, the fisheries of the world can also be affected. The British Columbia is also discussing the issues, there are the researchers in the universities, as the University of British Columbia have stated that if the temperature is warmer than there could be the decrease in the maximum sizes of the marine fishes because fishes can suffer in the water. The researchers ion the climate changes can have many bad impacts on the countries of the economies, however, the increasing pollution can warn the water, due to global warming the ocean temperature can also get warm. However, due to the warmer ocean temperature, there could be many issues take place, example oxygen level can be lessened in the countries and carbon dioxide level can be increased, which can also reason in the increase of deaths or death rate. The productivity of marine life can be reduced or lessened as the lives of fisheries are in danger, due to the increase in the global warming. However, the economy can also be affected due to the global warming, people can suffer across the countries, the food resources may be lessened, and due to the increase in water temperature, may issues in the economy, can take place (Gaworecki, 2016).

  • An economic issue affecting Canada economy. Example the cross-border shopping, Canada taxation policies, the Harper government, energy policy etc.

Date of Publication: 10 March 2016

Website/ Name of news Print: Politics Canada

Title: Bad Government Policies Are Undermining Canada’s Growth

Source: http://www.huffingtonpost.ca/charles-lammam/slow-economic-growth-canada_b_12272708.html

Author: Charles Lammam

Economic concept covered: Tax Policies

Summary of article:

The author Charles Lammam, have discussed about the bad government policies in the news article, as he has stated that the government of Canada has the bad policies, the Canada is the state, where maximum where maximum taxes are taken from the individuals, but there is the slow economic growth in the country, because the policy is not good. There are may be some global forces that are influencing the governmental policies because the government has increased the debts fix the higher taxes and increased the regulation ion the recent years. If the government has increased the taxes, then is the need to increase the economic growth for the development of the country and the people, however, as compared to the paying debts, from the public the economic development in the country is slower. The debts have increased for the households, which can face by the future generation, the people who are educated and more skilled have to pay more taxes in the country, the high or uncompetitive tax can de-motivated the people, or they could be discouraged in the way, as they will not work. Moreover, people will not invest, save, entrepreneurial or work more if the taxes are the increase in this way. The policies are affecting on the societies, there are the economic damaging policies, which are affecting the mind and thinking of the people. People of the country, are paying more and getting less, in this way they can be disappointed and stop working, the government need to make the policies or implement the taxes favorable for the people of the country (Lammam, 2016).

  • Economic issues affecting the world or a specific countries economy. Example, China real estate bubble, the global impact of the 2008 Global Financial Crises.

Date of Publication: 16 October 2016

Website/ Name of news Print: Vanguard

Title: Economy at 56, unemployment, technology deficit major obstacles

Source: http://www.vanguardngr.com/2016/10/economy-56-unemployment-technology-deficit-major-obstacles-umar/

Author: Undeme Clement

Economic concept covered Unemployment

Summary of article:

The author Undeme Clement have discussed the economy at 56, unemployment, in the news article, as the article has stated that in Nigeria, there are over 8,000 job losses, due to the port concession. However, in Nigeria and other related countries, this happens because workers are not fit and the country does not give the wages to them. At the 65 years, there is more need of the money, but no economic condition is favorable for them, the country has unemployment, people are struggling in the lives, people have to suffer there because there are no faculties, the job is not there. However, other countries as if America and Canada are taking care of the citizens they are given the amount of money so that they can be helped. In Nigeria people are suffering because no adequate facilities are given, like Nigeria, there are also many countries suffering from the unemployment, at the 65. Empowerment of the people in Nigeria is more important so the people can be motivated to work, however, they are discouraged, there are need to focus on the employment aspects so that people can be benefited, there is a need to stop owing to the worker salaries so that betterment can be there. Looking at the economy, at the 65 is more painful for the people of Nigeria, because the salaries are unusual and decided by the government. People need to be secure in the country, by giving them the proper financial needs, so they cannot be disappointed (Clement, 2016).

  • A technological issues or innovation that is affecting the world economy or changing the way of the human life. example mobile phone technology and their impacts on society.

Date of Publication: 18 October 2016

Website/ Name of news Print: Education News

Title: Does Sleep Deprivation Affect College Student Performance?

Source: https://www.goodcall.com/news/sleep-deprivation-affect-college-student-performance-08947

Author: Terri William

Economic concept covered: Technological’ effects on Economy

Summary of article:

The author Terri William, in the article sleep deprivation, affects college students, he has discussed the technology that iPads and phones are becoming important in the lives of the students, 51% of the students have said that they spend more time on a computer, doing the non-school-related activities. Students need to spend time on the iPad, due to which they sleep less, however, William admit that she spend 30 minutes on the iPad before she going to sleep. Every person or student is spending the most of the time, in using the technologies, as there are socially associated with the technology and using technology can give them satisfaction. Moreover, the technology has influenced on the behavior of the people; people are getting addicted and using the technologies because they feel relaxed. The article states that people or students have said that they require more time to sleep, because, in the midterm and other examination, they gave to wake up, using the laptops or iPads, however, the technology has changed our lifestyles of sleeping. People are not healthy and are not perform well because technology is there, and people are more likely to spend more time there. In my point of view, future generation can also suffer regarding the technological aspects of the society, they may be not close to the parents and teachers but to the technology. If students are not giving the appropriate time to the studies and if they are not taking the adequate sleep then, they may not perform well in the society, and this the economy of the country can also suffer because people are inactive in their lifestyles and cannot work efficiently (WILLIAMS, 2016).

Categories
help writing college papers

partnership and limited liability partnership

Question 1: Was this relationship a partnership for a term or a partnership at will?

 The partnership for a term is that partnership which exists for a specified period or a specified event occurs. It is to be noted that such partnership can be dissolved prematurely by any of the partners that is involved in the relationship. However, the partners who will make an end to the partnership will be liable for the breach of the partnership.  On the contrary, the partnership at will means that in which both of the partners did not decide that they will remain partner until a particular term or completion of a specific under taking will reach to its end.

             This partnership can be breached without any liability. In the present case the Manny and Jason were engaged in the verbal agreement. The verbal agreement is very hard to prove, and there was no written and signed evidence of any of the partnership. Therefore, the nature of the partnership is a partnership at will. It is not written or other evidence regarding the partnership. Thus there is needed to keep in mind the difference between the partnership at will and a term partnership.

Question 2: Did Manny have the authority to hire additional laborers to work at the ranch after his injury? Why or why not?

            Both were engaged in the verbal agreement, and there was not specified agreement was made in respect of looking after the live stock. The Manny has decided to look after the live stock at the form. Therefore, he was responsible for the management of the livestock, and when he was unable to take care, he hired the additional laborer. There is no written agreement that he is not entitled to hire additional labor to look after the live stock.

            Therefore his actions cannot be challenged. The Manny has authority to withdraw funds or to take debt to manage his obligation. He was responsible to manage his part of the duty, and there was not agreement on the use of the funds or debt that is needed to be acquired based on the mutual consent. Therefore, it can be concluded that the Manny has the authority to hire additional labor to work. 

Question 3: Under the current UPA, can Al’s Feed Barn bring an action against Jason individually for the Cowboy Palace’s debt? Why or why not?

            In the current UPA, the AI’s is not in a position to take any action that deems against Jason for the debt Burdon. The total debt is equal to 32400 US dollars. The debt amount is huge All three partners were engaged in the partnership at will. There was no written agreement or clause present in the agreement that forces Manny to take debt with the mutual consultation with other partners in the agreement. Therefore, in the context of the partnership at will, the Jason is not responsible for the debt that is due for the partnership. 

Question 4: Suppose that after his back injury in 2011, Manny sent his mother and brother a notice indicating his intent to withdraw from the partnership. Can he still be held liable for the debt to Al’s Feed Barn? Why or why not?        

            In case the Manny sent his mother and daughter the notice regarding the breach the partnership, it will act as evidence that the many were involved in a partnership.  The partnership of a term requires that there should be evidence regarding the partnership with different clauses that are needed to provide proof. The proofs could be related to different duties and obligations that are needed in the management of the live stock.

             Therefore, once the letter is written, it may be sued as evidence that the partnership at will was existent.In such circumstances, this letter can be used to prove that the partnership was existent in Json, Manny and Grace Tarnavsky. Therefore, in such a scenario he is responsible for the debt to Al’s Feed Barn.

2nd Reviewing chapter 38th:  Limited liabilities companies and special business forms

Question 1: Would Davidson Masonry automatically be taxed as a partnership or a corporation?          

            A partnership is a business structure in which the ownership and the responsibility of the business are split between two individuals, and the partnership itself does not pay taxes. The taxes are deducted to the earned income of the both partners. Therefore, in that situation, the taxation will be automatically deducted as a corporation. The nature of the contract is registered as a partnership despite that both of the corporations have their own business entities in the contract signed by both corporations.       

 Therefore, it can be concluded that the tax will be deducted at the corporation level. The law does not provide authority that the tax will be automatically at the partnership level. This is an important consideration that is needed to be considered. The difference between the taxation at partnership and corporation level is important.            
Question 2: Is Davidson Masonry member managed or manager managed?       

 The member managed means that all members of the corporation bear the responsibility regarding the day to day activities of the business. On the contrary, the manager management means that the manager or the owner of the business is responsible for the concerns of the business. The difference is needed to be considering while managing the business. 

            Therefore, Davidson Masonry, LLC is managed by him and his wife. They were the sole responsible for the operations of their business. This means that the business was member managed.  All affairs of the business were managed by both husband and wife. Thus, the business was manager managed. The manager bears all responsibility.             
Question 3: When Davidson Masonry and Lafayette entered an agreement to work together, what kind of special business form was created? Explain.

            The special agreement between two of the companies to construct the bridge is a strategic partnership. The strategic partnership is established between two companies formalized with multiple business contracts. This is short term partnership that is carried out by the corporations. There are several reasons behind such formulations. In the present situation, both corporations are intended to take benefits from their expertise.

            Davidson Masonry was responsible for the concrete and structural works, on the contrary, the Lafayette will provide large-scale metal creation. This means that both corporations have specific types of the expertise. When they share such expertise, they will able to make the contract. Thus, both are in strategic partnership. Such kind of business partnerships is very important to facilitate each other.

            Some time it happens that a corporation is not in position perform the tasks on hand on their own. Therefore, in such a situation, both companies exploit each other’s expertise and get the benefit. The same was the case with the present relationship. The Davidson Masonry was the expert in the structural concrete work that is required in the construction of the bridge. Moreover, the Lafayette was able to provide metal creation at large scale.       Thus, the special business relationship was a strategic relationship.  
Question 4: Suppose that during construction, Lafayette had entered into an agreement to rent space in a warehouse that was close to the bridge so that she could work on her sculptures near the site where they would eventually be installed. She entered into the contract without the knowledge or consent of Davidson Masonry. In this situation, would a court be likely to hold that Davidson Masonry was bound by the contract that Lafayette entered? Why or why not?

            Both corporations have decided to conduct their part. It is not specified about the way such work will be performed. The partnership contract states that the Davidson Masonry is responsible for the concrete and structural work that is needed to perform in the construction of the bridge. Moreover, the Lafayetteis is responsible for the provision of the large scale metal work. This is the sole responsibility of them Lafayetteis to carry out its responsibilities without any consultation with the Davidson Masonry.

  Both parties are responsible for their task and responsibilities that are going to b carried out in the business partnership. Therefore, if the Lafayette makes an agreement to rent a space for the rent develop the sculptures for the bridge, then its actions cannot be challenged into the court. The business operations of the company are legal, and there is no obligation in that regard.

 The separation of the responsibility is evident in the contract. Both companies have to perform their part. At the completion of the specific responsibilities of both of the companies, the contract will be completed. Therefore, the court will not be likely to hold the stance that the Davidson Masonry is bound to make a contract with Lafayette. This is an important issue to be considered.

Categories
help writing college papers

Companies using a mentoring system for employees

Companies using a mentoring system for employees

Introduction

The contemporary corporate system has adopted and devised various strategies, methods, and techniques that could assist organizations in augmenting their effectiveness and calling them to use their resources in a better manner so that the cost of operation can be reduced and mechanisms, which pertain to operations, can be optimized.

Multiple studies, on the subject of organization-resources-effectiveness, suggest that of all resources, human resource is the most sensitive and considerable resource, as it is human resource, which has to exploit other resources for specific objectives. Therefore, companies use various methods and techniques to increase the potential of human resource by providing new skills and knowledge that directly pertain to organization’s corporate operations and tasks.

One, of the strategies or methods, is to mentor employee.

It is presumed that most of the new employees enter an organization with the limited knowledge and organizational understanding. In addition, employees find it difficult to synchronize organization’s objectives with personal objectives.  Therefore, the concept of Mentoring has been introduced by companies, firms or organizations so that these challenges could be addressed

In this study, we will exhibit the historical background regarding the employees and work, development of the mentoring system, pros and cons and statistics at the end along with sources.

Historic Background

The concept of Mentor is not new, but rather quite ancient. The term first appeared in Greek Tragedy, Homer’s Odyssey, in which the protagonist, who is unaware of his potential and character attributes is mentored by goddess Athena that appears in the form of an old person to guide the protagonist, Telemachus. This clearly depicts that this idea that an individual needs the guidance of a person/mentor with greater experience and understanding, is very old.

The study on this subject also reveals that this idea was not limited to Greece, but in different cultures too it was present in various forms. For instance, in the Asiatic cultures, the relation between guru and disciple in many ways reflect the mentoring system. The guru (master) not just transfers his/her knowledge in various forms, by using various instruments and methods, to the disciple, but also aid disciple to identify his/her goals. The term used for the identification of goal, in ancient Sanskrit literature, is Marg-Darshak, which literary translates to goal-recognition (Dziczkowski, 2013).

From this discussion, it is very apparent that this concept of mentoring is not new, but rather old. Further from the systematic study of literature, we learn that organizations have been using this concept since the very emergence of the corporate system; however, during this post-modern economic/corporate age, companies have formally introduced it by making it more methodical. It is also very imperative to understand that term mentoring is different from coaching, as the preceding term has greater depth (Garvey, Stokes, & Megginson, 2014).

Every system that is adopted by the organization has a cost. Systems that are considered the most optimal or finest have minimum cost (The Economist, 2014).

After discussion of the historical background, the essay will illustrate the developments of the mentoring system along with prominent pros and cons. This is good to elaborate the mentoring systems and identify the strengths and weakness to have valuable outcomes at the end. These pros and cons can help the management to make effective decisions for the employees for a long run.

The Development of Mentoring System

Now when it is established that mentoring is not a contemporary idea, but rather an ancient idea; we have contemplated on the development of the idea, an informal tool to a forming method employed extensively, throughout the corporate, by organizations, to realize their objectives. From the study of organizational development and evolution, it is apparent that this concept has remained relevant and is being implemented for many decades. However, as the organizations have developed and evolved so as the concept. Before we discuss the development of the mentoring system and its transition from an informal technique to formal and comprehensive method/strategy, it is imperative to discuss the progress of organizational structure and the improvement of strategies and instruments for implementation.

As the structure of corporate system developed or progressed, so does the strategies and methods. The increased competition, because of the globalization of economies, compelled companies/organizations to improve their systems to increase their ability to perform a task. During this process, companies or organizations realized that they must increase their capacity to optimally use their resources, especially sensitive resources, such as human resource. Therefore, the process of development of human resource begun and companies started to increase allocate and invest resources in their most sensitive resource.

Different strategies and methods were employed to provide skills and knowledge to the employee. When we scrutinize these methods and instruments, we find out that each method has its own strength and weakness. When implemented appropriately, the strength of these strategies/methods reward them; whereas when not implement cautiously and effectively, the cost of this system is paid by the organization.

This is also true for Metering system, in which a mentor invests time and knowledge on an employee, which aims to increase the potential, ability or capacity of the new employee. There thorough understanding of this system suggests that there were strength and weaknesses of this system, which makes it quite difficult for an organization to adopt and implement it (de Janasz, 2013)

There are three prominent pros regarding the mentoring system in the organization. These are experienced realm, identification of different strength and weakness, and adoption of new skills. The elaboration of these pros is as under.

Pros

  1. Introduction to the Experienced Realm: Through mentoring an employee smoothly enters experienced realm. Generally, the corporate life of an employee is based on trial and error method; however, as the cost of error is usually high; therefore, an employee is more conscious and strives to reduce the frequency of committing an error. When an individual/employee has a mentor, he is guided by an experienced individual that guides him/her, which directly results in reducing errors. In addition, the employee is able to perform a task, because of the assistance/guidance, in a better manner that requires not only fewer resources but also less physical and mental investment from an employee. This also facilitates an employee to address to matter is the most appropriate fashion, which decreases the burden on employee and able him/her to produce desired results by investing his physical and mental energies. To appropriate methods and tools, required to perform a task, an employee needs time. The duration of this period varies upon the ability or learning curve of an employee. However, with the mentor, the experience can be gained in short period. 
  2. Strength and Weaknesses: It is a known fact and studies endorse it that those individuals, who identify their strength and weakness perform better than those, who have not identified their strength and weaknesses. As this require higher awareness and greater understanding of oneself; therefore, only a few are able to identify these on their own. These realities make the mentoring system very relevant and valid for the corporate system. Mentors aid mentees in not only recognizing their strength and weaknesses but also facilitate them in overcoming their weaknesses. This process is very hard and sensitive; though it could be made easy, if the mentor is experienced, concerned and sincere. It is also imperative to mention that when an individual knows about his/her strength and weaknesses, it becomes easy for him/her to identify/chose goals. In this manner, he/she is able to invest his efforts for that objective, which is achievable and relevant.
  3. New Skills: New information not only increases knowledge, but also it provides new skills. The systematic study of the organization makes it apparent that most of the resources and time of an organization is invested in providing new skills and relevant knowledge that directly pertain to the operations of the organization. The mentoring system can reduce the use resources, such as time, to increase the effectiveness of an employee. The mentoring system is considered an effective method of providing new skills and knowledge; however, it has its own limitations. However, as these limitations are few and the advantages many; therefore, mentoring is widely employed, formally or informally, to produce the desired outcome.

  There is no system that has no cost; therefore, when a system is considered, not just its strength is computed, but also an organization considers its weakness.  In additional, the organizational structure also amplifies, to an extent, the strength and weaknesses of a strategy or method, such as mentoring system. Therefore, when an organization adopts a system such mentoring system, it does not only evaluates its overall strength and weaknesses but also estimates how these much this strength and weaknesses will be affected by organization’s structure and work environment.

Despite having the valuable pros, there are also some cons. Now, this is better to illustrate the cons, which can help the management to eliminate the flaws in the mentoring systems and come up with some effective action plans. The cons are limited employees, relationship between mentor and mentee and efficiency in reality. The elaboration is as under.

Cons

  1. Organization’s environment: As metering can be provided too few individuals; therefore, only a few of the employees can be selected for this purpose. Generally, organizations aim to increase the potential certain employees so that it can create a multiplier effect. However, when few employees are being treated specially and others are ignored, this adversely affects the overall environment of the organization and this may increase negative work deviance. As per some studies, negative work deviance affects an origination in more than one way; one of the most obvious and frequent outcomes is a financial loss.
  2. The disintegration of Relationship: It is apparent that relationship between mentor and mentee is based on trust and because of that it is a very sensitive relation. Studies suggest that when the bond between mentor and mentee is strong, the results are positive; however, when the relationship is not an idea; the results could be detrimental for both mentee/mentor and organization. Therefore, installing this system formally is very perilous and maybe that is the reason why companies have not formally introduced this system to increase the potential of selective new employees so that it could produce a multiplier effect. We can conclude that cost and reward, of mentoring system, are very high. The repercussions, of disintegrated association, deter many companies from employing this method formally.
  3. Disingenuous Mentor: This is common that individuals project to be what they are not, for specific objectives. This is also true for the employees that work in an organization. They may be able to project that they are effective employees, with great understanding and skill; however, in reality, they may not be so effective and brilliant. If a company chooses such mentor to guide an employee (mentee), this will create multiple challenges. This will not only destroy the potential of the employee, but also this will reduce the overall efficiency of organization (Sravani, 2016).

Statistics

Empirical evidence endorses this perception that employees, who have a mentor, do better than those, who do not have mentors. As per the research, conducted by Sun Microsystems, in which career of 1000 employees was systematically scrutinized (n=1000), the results were in favor of mentoring system (Quast, 2011).

  Sample Size Career Duration Like to get Raise Received Raise Promotion
Mentor N=1000 5-years 20% approx 28% Six times
Mentee N=100 5-years 20% approx 25% Five times
http://www.forbes.com/sites/lisaquast/2011/10/31/how-becoming-a-mentor-can-boost-your-career/#795fce55662a

Conclusions

The mentoring system is an effective system that can produce results for an organization; however, the cost, of an ineffective mentoring system, is very high. Therefore, an organization must work on this subject and compute the cost and reward of an ineffective and effective mentoring system, respectively. We have already discussed that the system is being used and because of that it perpetually developing. For an organization, which intends to install this system, it is imperative to develop it according to its needs and requirements. This will reduce the flaws in the system and make it more potent. All systems, which are installed to increase resource utility and potential, are installed to meet specific ends. When a system fails to achieve identified goals, it must be improved or substituted by more effective and potent system.

For the mentoring system, the organization should develop instruments and tools that would help the organization to identify not only genuine mentors but also employees that can swiftly increase their potential, as per required by the company. However, the final decision or the true discretion is of the company, which needs to take a decision after considering all factors, including the structure of organization and work environment.

References

De Janasz, S. (2013). Dual sources of support for dual roles: how mentoring and work–family culture influence work–family conflict and job attitudes. The International Journal of Human Resource Management , 1435-1453.

Dziczkowski, J. (2013). Mentoring and Leadership Development. The Educational Forum , 351-360.

Eby, L. T. (2007). Definition and evolution of mentoring. The Blackwell handbook of mentoring: A multiple perspectives approaches , 7-20.

Garvey, B., Stokes, P., & Megginson, D. (2014). Coaching and mentoring: Theory and practice. Sage.

Quast, L. (2011). How Becoming A Mentor Can Boost Your Career. Retrieved October 17, 2016, from Forbes: http://www.forbes.com/sites/lisaquast/2011/10/31/how-becoming-a-mentor-can-boost-your-career/#795fce55662a

Sravani. (2016). Mentoring at Work. Retrieved October 17, 2016, from Wise Step : http://content.wisestep.com/mentoring-work-importance-benefits-pros-cons/

The Economist. (2014). Getting up to speed. Retrieved October 17, 2016, from http://www.economist.com/news/special-report/21593592-biggest-professional-training-system-you-have-never-heard-getting-up-speed

Categories
help writing college papers

Forest Gump (1994)

Forest Gump

Virtues or vices 

There are couples of virtues that have been seen in the movies. These needs to be implemented as the best of the person needs to be seen. Here the mission is that how a person could be made better.

Virtues in the movie

We can see that the movie is one of the greatest movies of all time. The movie has won many Oscars and many awards in the year. The movie is a kind of comedy but it is very helpful for the youth now a day as it gives many good lessons at the end. However if we look in to the movie we come to know that there are much virtues that we can see in the movie at the end. Describing some of the in a manner I will list them as

  • Wearing leg braces but still carry on and do every thing
  • Forest work hard and come to know that he could run fast without leg braces
  • Got football scholarship
  • Joined army
  • Awarded medal of honor
  • Made US$25,000 from ping pong endorsements
  • Started business of shrimping boat
  • Shares in Apple
  • Do not left his love throughout
  • A courageous man

Here we can see that forest was wearing leg braces from the childhood, we can see that still he was courageous and was able to do everything he goes to school and do everything as good as the normal child does. We can see that once a group of bullies was behind him and him run so that he could be far. However, it can be seen that by running fast, the leg braces brooked and we can see that he ran so fast that he entered the football stadium.

There trails were going on and we can see that the coach selected him as he saw a boy running so fast. Later he was selected in the college team; he was awarded and gone to the next level of competition.

Forest was so good in everything and that was the reason he joined the army, which is not an easy task to have. There we can see that he was sent to the war in the Vietnam and many of the colleagues died over there. Forest was wounded much. However, he stayed alive and helped the others as well. It was the reason he was given the Medal of Honor for that. Looking at that we come to know that he is a brave person and a good man indeed.

At that time he has learned the Ping-Pong and by the endorsements we can see that he made tons of money. I mean he was a hardworking person in the movie, which motivates the viewers. Further, it can be seen that he started the business of the shrimping boats. Due to hurricane, the other boats were damages and he and the partner makes lot of money with that, bought all new shrimp boating fleet, and was well established at that time. We can see he was a sharp thinker as well as he re invested his money.

After that, we can see that forest invested in Apple Company so that there would be no problems in term of money for him. With all the examples above, we can see that forest was a courageous man and the best thing, which was depicted that he was loyal as well. He does not left his love till the end. He also proposed her but we can see that the loyalty of forest wins at the end as he has married with her as well.

Vices in the movie

Here now looking at the movie in the negative direction we also find some of the negativity in her, w can see that at couple of point it gives the wrong direction or the negative aspects of life as well. Some of them are stated below

  • Forest was intellectually challenged and to have admission her mother had sex with the principle
  • Forest love Jenny was expelled from college for having topless photos
  • Forest asks to marry jenny but she declined him.

 Looking at the vices we come to know that the bad habits or the things that prevails in the movie. We come to know that it was difficult for forest to have the admission and due to that; the mother had sex with the principle. Actually this is the wrong thing that is predicted and the reason is that there could be many other possibilities to get the admission. To give you to anyone is not one of the best actions that are depicted from the movie.

In the movie, it can be seen that the girl Jenny was not so good as she was in to different drugs, the bad company she had. One of the issues w can see that she was a member of different parties as well. However, she was fired from the college as her topless photos could be seen. Hence, this is not the good point that was depicted in the movie.

However, another point that comes in the mind is that the forest was happy with jenny,, however he loved her. In real, she was not a good girl and she rejected him. She know that he is loyal and do loves her. Here the negligence can be seen and it needs to be eliminated as well.

Lessons that are essential to become good Human Being

We can see that there are many thing that we have actually come to know, what are the Virtues and the vices that are shown in the movie. I have learned a lot and there are couples of things that are listed here which are important in making me good human being. 

Forrest dependably proclaims everything that is at the forefront of his thoughts, and it makes everybody laugh hysterically or helps them understand something colossal about themselves. At times, it can be somewhat hostile yet nobody truly minds, since he generally implies well. Whether it is the woman at the transport stop or the president of the United States, Forrest treats everybody precisely the same with equivalent regard, additionally with equivalent genuineness. Chestnut nosing does not exist in Forrest’s reality, because regardless of the status, a man is a man.

Forrest never delays to exhibit and express his affections for those he thinks about. He bears everything to all onlookers, and everybody who matters to Forrest realizes that they matter to Forrest. Much the same as he is not hesitant to express his look after others, he is not reluctant to love profoundly, from the base of his spirit. He is not apprehensive of getting hurt, and he does not over think he simply cherishes. Many people could gain from this effortlessness.

Forrest encounters numerous passing’s of those he thinks about. Much the same as every single other feeling, he feels his pain emphatically and simply. He does not close anybody out, yet rather confronts it head-on: by going to their graves and addressing them like he generally did. He confronts demise with his mom’s recommendation: Somebody requests that Forrest play ping-pong. He takes the oar and does it – and he gives his regular abilities a chance to kick in. Overall, who knows what you are great at on the off chance that you do not attempt?

Overall, in any event you attempted if we do not participated then its ok, no problem with that. Lieutenant Dan may have needed to die on the combat zone; however, Forrest was not going to give that a chance to happen. Your heart might pull you in one heading, while others are instructing you to go the inverse course. Continuously believe your gut sense. It might simply spare someone’s life.

Always says that I am superior and I can do everything that is how we can change the life. As the amazing Mama notes, society directs what “ordinary” is. It does not generally have a genuine definition – it is all relative. Never feel like you must be “typical.” Let your oddity hail fly.  Forrest does not give a hoot about “ordinary,” and look what happened: he made The King renowned and helped somebody concoct the smiley confront and a smart guard sticker. What’s more, he had positively no clue. Act naturally, and recollect that your activities matter in more courses than you know…

As I would like to think, a stand out amongst the saddest minutes in the motion picture was when Jenny rejects Forrest’s proposition to be engaged, and he raises an especially brutal affront that she had tossed at him forever and a day back. Easygoing fellowships go back and forth, yet when Forrest discovers individuals, he really clicks with, he knows how unique it is and he does not release that.

Firstly, frozen yogurt is wonderful. Never forget how amazing frozen yogurt is. Besides, dependably impart to a companion or cherished one in need—regardless of the possibility that that specific individual dumps your offerings in a bedpan. Carry on with your life how you need to. Take an interest in exercises essentially in light of the fact that you need to. Not all that matters needs to have a more profound significance but rather when you begin doing what you adore, it will build up a more profound importance all alone.

We need to remember whatever has been happened in the past in any case so that we could move forward in the better way. The above lessons are mentioned which I have learned from the movie and I thing by focusing on the above points a better human being can be formed. The reason behind it is that everything is positive and it is worth full as well.

Here we can see that there are couples of things that are mentioned in the above paragraphs so that the main things are looked in the deep analysis and we can see that by fulfilling all these things we can see that I can be a good human being at the end.

Source: http://www.imdb.com/title/tt0109830/

Categories
help writing college papers

On poem “If_ by Rudyard Kipling”

Analysis of poem “IF” by Rudyard Kipling

“In order to be the best person one can, it involves having complete control over your decisions and emotions in every situation, whether it’s your thoughts, actions, or reactions”

Introduction

            “If—“ is the poem written by  Rudyard Kipling who was a British Nobel laureate. He wrote this poem in 1895 in paying tribute to Leander Starr Jameson. Rudyard has written this poem is from of a parental advice to John, his son. Behaviors and qualities of a person play important role in defining the personality of a person. It is important to have a stable personality to be a good person. People in this world belong to different countries, religion and have different personalities, thoughts, and emotions that lead them to perceive the same situation differently. According to the trait theory, People are different based on behavior, traits, and emotions. Some perceive the situation positively and some perceive the same situation negatively.

Analysis         

For the purpose of becoming the best person one can, controlling the emotions and decisions in every situation is crucial. A person has to control his/her actions, thought and reaction regarding certain circumstances. According to the five personality traits, that are; extraversion, emotional stability, neuroticism, agreeableness, openness to experience and conscientiousness, People might have any of these personality traits. The personality of a person has determined with the help of behavior and emotion that a person shows in a problematic situation and in a normal situation. Qualities of a good person require good personality traits. It is important for a person to bec0me emotionally stable person so that one can handle the situation effectively and positively. Now in this fast moving country, people are becoming aggressive because of tensions, problems, and differences. Most of the people have neuroticism personality traits that lead them to behave negative and aggressive even in a normal condition. The poet is telling his son to keep a control on your senses in the beginning of the poem by saying “If you can keep your head when all about you, Are losing theirs and blaming it on you,”

            The central idea of the poem is that the success does not come to the people who are emotionally unstable and do have the sense to value things. If a person is facing difficult time then it is important for a person to have stable heart, emotions, and behavior. One should not behave negative or should not have a negative thought that may affect the personality of a person. On the other hand, success comes to those who are emotionally stable, have confidence and know how to behave and handle problematic situations in life with patience. Rudyard says “If you can wait and not be tired by waiting, Or being lied about, don’t deal in lies,” which means that he is telling his son to stay calm and patient and keep working on you goal.  Successful people consider the problems and bad time as a part of life and find ways to deal with them. They do not get hyperactive and aggressive but feel calm and confident.

            The poem “IF” by Rudyard Kipling entails the qualities of a good person. It talks about the importance of good qualities, behavior, reaction and positive emotions of a person in everyday life. Some of the characteristics mentioned in the poem are “if you can keep your head” , If you can wait”, “don’t deal in lies”, “if you can dream”, “if you can think”, “if you can bear to hear the truth” and many others. The first stanza of the poem, deal with the ideal traits that a person should have.

            The first stanza entails that it is important for a person to be confident in making decisions and important steps in life and a person should take responsibility for these decisions. It is also mentioned in the poem that when a person fails to take responsibility for his or her own decisions, he or she reacts in a negative way. If others fail to take the responsibility of their own, it is the duty of other people to treat them with love and patience. People should tolerate this kind of people and should not reduce themselves to their level by having a feeling of hate or telling lies. Rudyard says at the end of the first stanza, “Or being hated, don’t give way to hating, And yet don’t look too good, nor talk too wise,” However, it is important that people should not think themselves as they are superior or are above other people. 

            The second stanza of the poem entails that one should and must dream about life and should dream about the things one wants to achieve in the life but the most important point to remember is that, do not let your dreams control you. In the first line of second stanza, the poet says “If you can dream—and not make dreams your master;” If you rely on want to achieve something valuable in your life they put efforts and actions to achieve it. Happiness, bad time and problems are the part of the life. When some have dreams and thoughts to achieve something then he/she has to face many situations and hurdles in life. Problems and hurdles do not mean that the person should stop thinking sand struggling but it is the way of learning new things and experience new things as the poet refers to the “And stoop and build ’em up with worn-out tools:” which means that he is telling his son to leave old way of thinking and shape the personality and way of thinking.

             The third stanza of the poems entails that the one should not afraid to take risks. People who are always ready to take risk usually have success in the life. They consider the risk as a challenge and find a way to achieve and fulfill the challenge. Success and failure are also a part of life one should not take it personally and should not stop struggling about the goal he/she dreamed. If someone fails, it is important to face the situation with confident and to think of another new way to achieve the goals. The poet says that “If you can make one heap of all your winnings” which exactly tells that one should keep moving on with the life and don’t stop.

 To have a big valuable thing in life requires a lot of hard work and a lot of struggle by a person. There is nothing in life that a person can achieve without any hardship or without any effort. Try, try and keep try until you achieved your desired goals in life. The poet says, “And lose, and start again at your beginnings” telling his son to keep fighting to achieve the goals you have set for your life. Always make yourself ready to accept the risk as a challenge. A person should be confident while making decisions and plans. The people who are extrovert, emotionally stable usually have success in life. They perceive the situation positively and make other people think positive in life. They do not get hyper on having duties and responsibilities in life but they perform their duties and responsibilities effectively and efficiently. Emotionally stable people usually have a problem-centric personality that helps them to find out ways and solution to a problem rather than having emotion-centric personality in life.

            The fourth stanza of the poem entails the behavior of people towards other people. In life, a sometimes situation comes in which people try to change and influence one’s belief.  On the other hand, sometimes people around us teaches us a way to differentiate what is right and what is wrong and teaches us what is moral and immoral in life. If one knows the beliefs, needs and wants and know the clear meaning of the goals then no one in the world can change the thinking and perception of a person towards the goals. The poet says “If neither foes nor loving friends can hurt you,” to tell his son that no one will be able to hurt your emotions because you have better knowledge, information and understand better about himself. Therefore knowing yourself better than other is also important that also helps a person to have controlled personality.

            People should help each other in life and should give importance to each other emotions sometimes people depend on each other and help each other but it does not mean that they fully depend on us that make us forget about our importance and our important goals in life. In the last stanza of the poem, it is important for a person to fully enjoy the life by following the important steps that help to become a good person. 

Conclusion:

            To conclude it, writer of the poem completely explains the ways that a person should follow in order to become an ideal person and to have a good personality. The poem entails that the effect of personality on the people in making important decisions life.  The writer of the poem entails that the people should have control over their emotions and behaviors, especially in making decisions and perceiving the situation. In life, different kind of situation occurs but it is important to have a stable personality and positive way of thinking.